OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Mgll (NM_011844) Mouse Untagged Clone

Be the first to review this product
SKU
MC202347
Mgll (untagged) - Mouse monoglyceride lipase (Mgll), transcript variant 2, (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA363133 MGLL Antibody - middle region
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Mgll or NM_011844"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Mgll
Synonyms AA589436; Ma; Magl; Mgl
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC057965 sequence for NM_011844
CGCGCGCAGTAGTCTGGCTCTAGCCCGCCGCAGACCCGGACCCGCGTGGTGCTCGGGGAACGTGACAGCG GCGCTCGTGGCCCGGGGCCTAAAGACCCCTGCAGGATGCCTGAGGCAAGTTCACCCAGGCGAACTCCACA GAATGTTCCCTACCAGGACCTGCCTCACCTGGTCAATGCAGACGGACAGTACCTCTTTTGTAGATACTGG AAGCCCAGTGGCACACCCAAGGCCCTCATCTTTGTGTCCCATGGAGCTGGGGAACACTGTGGCCGTTATG ATGAGCTGGCTCATATGTTGAAGGGGCTGGACATGCTGGTATTTGCCCATGACCATGTTGGCCATGGGCA GAGTGAGGGAGAGAGGATGGTGGTGTCGGACTTCCAAGTTTTTGTCAGAGATGTGCTGCAACACGTGGAC ACCATCCAGAAGGACTACCCCGACGTCCCCATCTTCCTCCTGGGCCACTCCATGGGCGGTGCCATCTCCA TCCTAGTGGCTGCAGAGAGGCCAACCTACTTTTCTGGCATGGTCCTGATTTCACCTCTGGTCCTTGCCAA TCCGGAATCTGCATCGACTTTGAAGGTCCTTGCTGCCAAACTGCTCAATTTTGTCCTGCCAAATATGACC TTGGGGCGCATTGACTCCAGCGTGCTGTCTCGGAACAAGTCGGAGGTTGACCTGTACAACTCTGACCCAC TCGTCTGCCGAGCAGGGCTGAAGGTGTGCTTTGGCATACAGCTGCTGAATGCCGTCGCAAGAGTGGAGCG AGCAATGCCCAGGCTGACACTGCCATTCCTGCTGCTGCAGGGTTCTGCTGACCGGCTTTGCGACAGCAAA GGTGCCTACCTGCTCATGGAATCATCCCGGAGTCAGGACAAAACACTCAAGATGTATGAAGGTGCCTATC ACGTCCTCCACAGGGAGCTTCCGGAAGTGACCAACTCCGTCCTCCATGAAGTAAACTCGTGGGTGTCTCA CAGGATAGCAGCAGCAGGAGCTGGGTGTCCACCCTGAACATGCTGGCCAGGCAACCAGCTCATGGTCTGG GGGGAGGCAGGCAGAGGAAGGGCAGTGCTGGCTGGCTCAAAAAAAAAAAAAAAAATCACAAATTGGAGGA ACCCTTAGTACCCTAGTGCAACTTGCTTTGGGAAAAAAAAAAAGGATCATTTGTCATATAGATGGCTACT GGCCACTGATCTACTACCTTAAGGAGCAGGCACTTTATGAAGGAGGGAGTATATTTTCTACACAGAGACT GTGTGGAAATATCCTTTGAATTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI |
ACCN NM_011844
Insert Size 912 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC057965, AAH57965
RefSeq Size 1316 bp
RefSeq ORF 912 bp
Locus ID 23945
UniProt ID O35678
Cytogenetics 6 D1
Summary This gene encodes a monoglyceride lipase, which catalyzes the hydrolysis of monoglycerides into fatty acids and glycerol. This enzyme is also thought to hydrolyze the endocannabinoid 2-arachidonoylglycerol. Alternatively spliced transcript variants have been described. provided by RefSeq, Oct 2009
Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (b) is shorter than isoform a.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_011844" in other vectors (4)
SKU Description Size Price
MG204234 Mgll (tGFP-tagged) - Mouse monoglyceride lipase (Mgll) 10 ug
$500.00
MR204234 Mgll (Myc-DDK-tagged) - Mouse monoglyceride lipase (Mgll), transcript variant 2 10 ug
$289.00 $300.00
MR204234L3 Lenti ORF clone of Mgll (Myc-DDK-tagged) - Mouse monoglyceride lipase (Mgll), transcript variant 2 10 ug
$600.00
MR204234L4 Lenti ORF clone of Mgll (mGFP-tagged) - Mouse monoglyceride lipase (Mgll), transcript variant 2 10 ug
$600.00

file-alt Citations

Monoacylglycerol lipase regulates cannabinoid receptor 2-dependent macrophage activation and cancer progression
Xiang, Shi, Kang et al
Nat Commun (2018) 9 (1), 2574 DOI: 10.1038/s41467-018-04999-8
AI Summary: OriGene’s MGLL cDNA clone (MC202347) was used to overexpress MGLL in macrophages, enabling the study of MGLL’s role in macrophage activation and cancer progression described in the paper.
Snippet: ent of stable cell lines pCDNA-MGLL RAW cells were established with stable overexpression of murine MGLL, and the control cells were pCDNA3.1-transfected macrophages. The MGLL cDNA was cloned from an Origene cDNA clone (MC202347). The gene cnr2 (Protein: CB2) in the MC-38 mouse cancer cells was knocked out using a CB2 CRISPR/Cas9 KO plasmid (sc-419723). The establishment of stable cell lines was v
FigureFigureFigure
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products