Gsdmd (NM_026960) Mouse Untagged Clone

SKU
MC202215
Gsdmd (untagged) - Mouse gasdermin D (Gsdmd), (10ug)
  $686.00
In Stock*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Gsdmd
Synonyms 1810036L03Rik; AW558049; DF5L; Dfna5l; Gsdmdc1; M2-4
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC029813 sequence for NM_026960
CCGGGTTGAGCAGACAATAGACCCCTCCCCGGCATCCCAGCAGGTCCTCGCTTCGCTTGGTGGACCCAGA TACCTCGGCAGGGGTGAAAAATCGAGGACCATGCCATCGGCCTTTGAGAAAGTGGTCAAGAATGTGATCA AGGAGGTAAGCGGCAGCAGAGGCGATCTCATTCCGGTGGACAGCCTGCGGAACTCCACCAGCTTCAGGCC CTACTGCCTTCTGAACAGGAAATTTTCAAGCTCAAGGTTCTGGAAACCCCGTTATTCATGTGTCAACCTG TCAATCAAGGACATCCTGGAGCCCAGTGCTCCAGAACCAGAACCGGAGTGTTTTGGCTCCTTCAAAGTCT CTGATGTCGTCGATGGGAACATTCAGGGCAGAGTGATGTTGTCAGGCATGGGAGAAGGGAAAATTTCTGG TGGGGCTGCAGTGTCTGACAGTTCCAGTGCCTCCATGAATGTGTGTATACTGCGTGTGACTCAGAAGACC TGGGAGACCATGCAGCATGAAAGGCACCTTCAGCAGCCTGAGAACAAAATCCTGCAACAGCTTCGGAGTC GTGGGGATGACCTGTTTGTGGTGACCGAGGTGCTGCAGACAAAGGAGGAAGTGCAGATCACTGAGGTCCA CAGCCAAGAGGGCTCAGGCCAGTTTACGCTGCCTGGAGCTTTATGCTTGAAGGGTGAAGGCAAGGGCCAC CAAAGCCGGAAGAAGATGGTGACCATTCCTGCAGGCAGCATCCTGGCATTCCGAGTGGCCCAACTGCTTA TTGGCTCTAAATGGGATATCCTTCTCGTCTCAGATGAGAAACAGAGGACCTTTGAGCCCTCCTCAGGTGA CAGAAAAGCAGTGGGCCAGAGGCACCATGGCCTCAATGTGCTTGCTGCGCTTTGTTCCATCGGAAAGCAG CTCAGTCTCCTGTCAGATGGGATTGATGAGGAGGAATTAATTGAGGCGGCAGACTTCCAGGGCCTGTATG CTGAGGTGAAGGCTTGCTCCTCAGAACTGGAGAGCTTGGAAATGGAGTTGAGACAACAGATACTGGTGAA CATCGGAAAGATTTTACAGGACCAGCCCAGCATGGAAGCCTTAGAGGCCTCACTAGGGCAGGGCCTGTGC AGTGGCGGCCAGGTGGAGCCTCTGGACGGCCCAGCTGGCTGCATCCTTGAGTGTCTGGTGCTTGACTCTG GAGAACTGGTGCCGGAACTCGCAGCCCCTATCTTCTACCTGCTGGGAGCACTGGCTGTGCTGAGTGAAAC CCAGCAGCAGCTGCTAGCTAAGGCTCTGGAGACAACGGTGCTGTCAAAGCAGCTGGAGTTGGTGAAGCAC GTCTTGGAACAGAGCACCCCGTGGCAGGAGCAGAGTTCTGTGTCCCTGCCCACCGTGCTCCTTGGGGACT GCTGGGATGAAAAGAATCCCACCTGGGTCTTGCTAGAAGAATGTGGCCTAAGGCTGCAGGTAGAATCCCC CCAGGTGCACTGGGAACCAACGTCTCTGATCCCCACAAGTGCGCTCTATGCCTCCCTGTTCCTATTGTCA AGTCTAGGCCAGAAACCTTGTTAGCCTGTGGGCCTCCCTTCCCACAACATCTCCATGTCCTACCCTCCAG CCAAGGTAGAATCTTGCCAAGCCTAGCCTTTGGGAAGCCAAGAACCATACTCAGTCACAGGGTTATAATG CACTGAGATCCAGAAGTTGGGAAAACTCAATAAATGTACAAAGGAAAGCATAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI |
ACCN NM_026960
Insert Size 1464 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC029813, AAH29813
RefSeq Size 1746 bp
RefSeq ORF 1464 bp
Locus ID 69146
UniProt ID Q9D8T2
Cytogenetics 15 D3
Summary Gasdermin-D, N-terminal: Promotes pyroptosis in response to microbial infection and danger signals. Produced by the cleavage of gasdermin-D by inflammatory caspases CASP1 or CASP4 in response to canonical, as well as non-canonical (such as cytosolic LPS) inflammasome activators (PubMed:26611636, PubMed:26375259, PubMed:26375003, PubMed:27418190, PubMed:27385778, PubMed:27383986). After cleavage, moves to the plasma membrane where it strongly binds to membrane inner leaflet lipids, including monophosphorylated phosphatidylinositols, such as phosphatidylinositol 4-phosphate, bisphosphorylated phosphatidylinositols, such as phosphatidylinositol (4,5)-bisphosphate, as well as phosphatidylinositol (3,4,5)-trisphosphate, and more weakly to phosphatidic acid and phosphatidylserine. Homooligomerizes within the membrane and forms pores of 10 - 15 nanometers (nm) of inner diameter, allowing the release of mature IL1B and triggering pyroptosis. Exhibits bactericidal activity. Gasdermin-D, N-terminal released from pyroptotic cells into the extracellular milieu rapidly binds to and kills both Gram-negative and Gram-positive bacteria, without harming neighboring mammalian cells, as it does not disrupt the plasma membrane from the outside due to lipid-binding specificity. Under cell culture conditions, also active against intracellular bacteria, such as Listeria monocytogenes. Strongly binds to bacterial and mitochondrial lipids, including cardiolipin. Does not bind to phosphatidylethanolamine or phosphatidylcholine (PubMed:27383986).UniProtKB/Swiss-Prot Function
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_026960" in other vectors (4)
SKU Description Size Price
MG207809 Gsdmd (tGFP-tagged) - Mouse gasdermin domain containing 1 (Gsdmdc1) 10 ug
$886.00
MR207809 Gsdmd (Myc-DDK-tagged) - Mouse gasdermin D (Gsdmd) 10 ug
$686.00
MR207809L3 Lenti ORF clone of Gsdmd (Myc-DDK-tagged) - Mouse gasdermin D (Gsdmd) 10 ug
$986.00
MR207809L4 Lenti ORF clone of Gsdmd (mGFP-tagged) - Mouse gasdermin D (Gsdmd) 10 ug
$986.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products