Elof1 (NM_170777) Mouse Untagged Clone

SKU
MC202133
Elof1 (untagged) - Mouse elongation factor 1 homolog (ELF1, S. cerevisiae) (Elof1), (10ug)
  $150.00
In Stock*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Elof1
Synonyms 1110011K10Rik
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC024488 sequence for NM_170777
CCCACGCGTCCGAGCGGCCTTGGCTGAGAGGCAGGGCTGGTACAAGTTTTATTCCCTCTGCAGTTATGGG ACGAAGAAAGTCCAAACGGAAGCCGCCCCCAAAAAAGAAGATGACAGGCACCCTGGAGACCCAGTTCACC TGCCCTTTCTGCAACCACGAGAAGTCTTGTGATGTGAAAATGGACCGTGCTCGAAACACTGGAGTCATCT CCTGTACTGTGTGCCTAGAGGAATTCCAGACACCCATCACATACCTGTCAGAACCAGTGGATGTGTACAG CGACTGGATAGATGCCTGCGAGGCAGCCAATCAGTAGCAAAGTCAGGGACCTGCTCCTCCACAGCCCCCA TCTGGCTACCAATCCAGAGACATTCCAGGGCTAGGACAGCCCGCCCTCTGCAGATGGGATGGATGTGAGT GAGTAGATTTCGTGGCTGCAGATGTGACTGTAGGGATGGAGGCGAGCGACACTGGGTCTCACCAAGCAGC CCAGGGTGGCCTCATGGAACCCTGAGCCTCAGGTGACTCTACAAGCCTTTGAGTTGCTCCCATCTTCAGC CCCCACCCTGCCCCCACACTTCAGGCTCCTGTCTTCTCTGGTGACGGTTCCTGACATCCAGGCAAGGAAT AGCTGTGGGACCTCCTGTCTCCTCAGCCACCTCACCAGCACCTTGCCCTTGGGACCTAGACTTTCTGTCC TTCCCATTCTCCTAGTGCTGTGGTCGAGGCTACTGGCCACCCAGGTCCCCTGGCTGGGCTCGGCTGGGGA ACACCATTTTCTTGGTTTGCCTTTGTAGACAAGGTAGGGGCTAGTTGGGGTACAGCTGTCATTCATTCAT GAGCCCATCAATAAAACAGCCAGTGTGTAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI |
ACCN NM_170777
Insert Size 252 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC024488, AAH24488
RefSeq Size 884 bp
RefSeq ORF 252 bp
Locus ID 66126
UniProt ID P60003
Cytogenetics 9 A3
Summary Transcription elongation factor implicated in the maintenance of proper chromatin structure in actively transcribed regions.UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (1) represents the longest transcript. All seven variants encode the same protein. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_170777" in other vectors (4)
SKU Description Size Price
MG200161 Elof1 (tGFP-tagged) - Mouse elongation factor 1 homolog (ELF1, S. cerevisiae) (Elof1) 10 ug
$350.00
MR200161 Elof1 (Myc-DDK-tagged) - Mouse elongation factor 1 homolog (ELF1, S. cerevisiae) (Elof1) 10 ug
$289.00
MR200161L3 Lenti ORF clone of Elof1 (Myc-DDK-tagged) - Mouse elongation factor 1 homolog (ELF1, S. cerevisiae) (Elof1) 10 ug
$450.00
MR200161L4 Lenti ORF clone of Elof1 (mGFP-tagged) - Mouse elongation factor 1 homolog (ELF1, S. cerevisiae) (Elof1) 10 ug
$450.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products