Wdr61 (NM_001025375) Mouse Untagged Clone

SKU
MC202099
Wdr61 (untagged) - Mouse WD repeat domain 61 (Wdr61), transcript variant 1, (10ug)
  $300.00
In Stock*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Wdr61
Synonyms 2700038L12Rik; 2810418I05Rik; REC14
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC023026 sequence for NM_001025375
GTGCGGCTGGCTGTACGGTGAACTGTCTGGCCTTTAGCGCTTCATCCTTGGTTAAGGAAATGACCAACCA GTACAGTATTCTCTTCAAGCAAGAGCAAGCCCATGATGATGCCATATGGTCAGTTGCCTGGGAGACAAAC AAAAAGGAAAACATTGAAACAGTGGTCACAGGATCCCTGGATGACCTGGTGAAGGTCTGGAAATGGCGTG ATGAGAGGCTGGAGCTCCAGTGGAGCCTGGAGGGACATCAGCTCGGGGTGGTGTCTGTGGACATCAGCCA CACTCTTCCCATTGCTGCATCCAGCTCTCTAGACGCTCATATTCGCCTCTGGGACTTGGAAAATGGCAAA CAGATGAAGTCTATAGATGCAGGACCAGTGGATGCCTGGACTTTGGCATTTTCTCCTGACTCCCAGTATC TGGCCACAGGAACTCACATGGGGAAAGTGAACATTTTTGGTGTGGAAAGTGGAAAAAAAGAATATTCTTT GGACACTAGAGGAAAATTCATCCTTAGTATTGCATATAGTCCTGATGGGAAATACCTGGCCAGCGGAGCC ATAGACGGAATCATCAATATTTTTGACATTGCAACTGGAAAGCTTTTGCATACGCTGGAAGGCCATGCGA TGCCCATTCGCTCCTTGACCTTTTCCCCTGACTCCCAGCTCCTTGTCACGGCTTCAGATGATGGCTACAT CAAGATCTATGATGTACAACATGCCAATTTGGCTGGCACACTGAGTGGCCATGCGTCCTGGGTGTTGAAT GTTGCGTTCTGTCCTGATGACACTCACTTTGTCTCCAGTTCATCTGACAAAAGTGTGAAGGTTTGGGATG TTGGAACAAGGACCTGTATTCACACCTTCTTTGATCACCAGGATCAGGTTTGGGGAGTAAAATATAATGG AAATGGATCAAAAATTGTATCTGTTGGAGATGACCAGGAAATTCATGTCTATGACTGCCCAATTTAAACA CCAGCATCCTCGGGGCTAGGGCCTCAGACTACACAGGGTTGATCATGACATTCCTCAGATTTTTTGGCAT ACTTAAAGTACAGCATATATTGTAGAACTTTTGTAGATACAATATAAATTTTTCCTGTTTTATTGGAAAT GTTCTTCATATTTTAATGTAAATAAAGCATTCTTAATGCAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI |
ACCN NM_001025375
Insert Size 918 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC023026, AAH23026
RefSeq Size 1174 bp
RefSeq ORF 918 bp
Locus ID 66317
UniProt ID Q9ERF3
Cytogenetics 9 A5.3
Summary Component of the PAF1 complex (PAF1C) which has multiple functions during transcription by RNA polymerase II and is implicated in regulation of development and maintenance of embryonic stem cell pluripotency. PAF1C associates with RNA polymerase II through interaction with POLR2A CTD non-phosphorylated and 'Ser-2'- and 'Ser-5'-phosphorylated forms and is involved in transcriptional elongation, acting both indepentently and synergistically with TCEA1 and in cooperation with the DSIF complex and HTATSF1. PAF1C is required for transcription of Hox and Wnt target genes. PAF1C is involved in hematopoiesis and stimulates transcriptional activity of KMT2A/MLL1. PAF1C is involved in histone modifications such as ubiquitination of histone H2B and methylation on histone H3 'Lys-4' (H3K4me3). PAF1C recruits the RNF20/40 E3 ubiquitin-protein ligase complex and the E2 enzyme UBE2A or UBE2B to chromatin which mediate monoubiquitination of 'Lys-120' of histone H2B (H2BK120ub1); UB2A/B-mediated H2B ubiquitination is proposed to be coupled to transcription. PAF1C is involved in mRNA 3' end formation probably through association with cleavage and poly(A) factors. Required for mono- and trimethylation on histone H3 'Lys-4' (H3K4me3), dimethylation on histone H3 'Lys-79' (H3K4me3). Required for Hox gene transcription. Component of the SKI complex which is thought to be involved in exosome-mediated RNA decay and associates with transcriptionally active genes in a manner dependent on PAF1C (By similarity).UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (1) represents the longest transcript and encodes the longer protein (isoform a). Variants 1 and 2 encode the same protein.
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001025375" in other vectors (4)
SKU Description Size Price
MG204285 Wdr61 (tGFP-tagged) - Mouse WD repeat domain 61 (Wdr61), transcript variant 1 10 ug
$500.00
MR204285 Wdr61 (Myc-DDK-tagged) - Mouse WD repeat domain 61 (Wdr61), transcript variant 1 10 ug
$289.00 $300.00
MR204285L3 Lenti ORF clone of Wdr61 (Myc-DDK-tagged) - Mouse WD repeat domain 61 (Wdr61), transcript variant 1 10 ug
$600.00
MR204285L4 Lenti ORF clone of Wdr61 (mGFP-tagged) - Mouse WD repeat domain 61 (Wdr61), transcript variant 1 10 ug
$600.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products