Folr2 (NM_008035) Mouse Untagged Clone

SKU
MC201960
Folr2 (untagged) - Mouse folate receptor 2 (fetal) (Folr2), (10ug)
  $300.00
In Stock*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Folr2
Synonyms FBP; FBP2; Fol; Folb; Folbp-2; Folbp2; FR-; FR-beta; FR-P3
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC022108 sequence for NM_008035
AAAGCTTCTATGTGGGGCTGTGGACGAAGACTGTAGAGACTACCCAGAGTCTGACCTAGGGAGAGGCCAA CTCGGATACCCCTATGTGCGCTCCCAGAAGCTAAGGACATTGAGACAGAAAGACATGGCCTGGAAACAGA CACCACTCTTGCTTTTGGTCTACATGGTCACAACAGGCAGTGGCCGGGACAGAACAGACCTACTCAACGT TTGCATGGATGCCAAACACCATAAGACAAAGCCGGGCCCCGAGGACAAGCTGCATGACCAGTGTAGTCCA TGGAAGAAAAATGCCTGTTGCTCAGTCAACACCAGCCAGGAGCTACACAAGGCTGACTCCCGTCTGTACT TCAACTGGGATCACTGTGGCAAGATGGAGCCTGCCTGTAAGAGTCACTTCATCCAAGACTCCTGCCTGTA TGAGTGCTCCCCCAACCTTGGGCCTTGGATCCAGCAAGTGGACCAGAGTTGGCGTAAAGAGCGTTTCCTG GATGTGCCCTTATGCAAAGAGGACTGTCACCAGTGGTGGGAAGCCTGTCGTACCTCCTTTACCTGCAAGA GAGACTGGCATAAAGGCTGGGACTGGTCCTCAGGCATTAACAAGTGCCCAAACACAGCACCCTGTCACAC GTTTGAGTACTACTTCCCGACACCAGCCAGCCTTTGCGAGGGTCTCTGGAGTCACTCCTACAAGGTCAGC AACTACAGCAGAGGGAGTGGCCGCTGCATCCAGATGTGGTTTGACTCAACCCAGGGCAATCCCAATGAGG ACGTGGTGAAGTTTTATGCTTCCTTTATGACATCTGGGACTGTGCCCCATGCAGCAGTACTTCTTGTGCC CAGCCTGGCCCCAGTGCTGTCATTATGGCTCCCTGGCTGAGAGGTCAGTCTTCCTCTCTAGATTTCTCCT CTATCTACCCTTGGTCTGGTTCAACTCTTCAAAGAATAAGGAAGTCTTGAGCCTGCTTCCACCCCTCTCC TCTGTCATCCAGTTCCTGATCCATGTTGGGGGTTGGGGTTTCTACAATCATTTTCAATAAATCTATGACA CATCTGGAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI |
ACCN NM_008035
Insert Size 756 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC022108, AAH22108
RefSeq Size 1072 bp
RefSeq ORF 756 bp
Locus ID 14276
UniProt ID Q05685
Cytogenetics 7 E2
Summary This gene encodes a receptor protein located on the plasma membrane that mediates folate uptake by cells. Mice lacking the product of this gene show no defects in embryonic development and grow normally into fertile adults. However, such mice were found to be highly susceptible to the teratogenic effects of arsenic. Alternate splicing of this gene results in multiple transcript variants. provided by RefSeq, Dec 2014
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. All variants (1-3) encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_008035" in other vectors (4)
SKU Description Size Price
MG203207 Folr2 (tGFP-tagged) - Mouse folate receptor 2 (fetal) (Folr2) 10 ug
$489.00 $500.00
MR203207 Folr2 (Myc-DDK-tagged) - Mouse folate receptor 2 (fetal) (Folr2) 10 ug
$289.00 $300.00
MR203207L3 Lenti ORF clone of Folr2 (Myc-DDK-tagged) - Mouse folate receptor 2 (fetal) (Folr2) 10 ug
$600.00
MR203207L4 Lenti ORF clone of Folr2 (mGFP-tagged) - Mouse folate receptor 2 (fetal) (Folr2) 10 ug
$600.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products