OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Dnase1 (NM_010061) Mouse Untagged Clone

Be the first to review this product
SKU
MC201502
Dnase1 (untagged) - Mouse deoxyribonuclease I (Dnase1), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Dnase1 or NM_010061"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Dnase1
Synonyms AI788650; DNaseI; Dnl1
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC014718 sequence for NM_010061
AGCGACCCTGAGAGCTAGCAGGTCTGTAATTCCACACTGCTTTTTGGTTTTTTCCTTTATACATTTTGTA AAAAGAATCTTCCTTTAAAAGCAAAAGGAGAAATATATATCAGAATTTTCCAGGTTAGTATCAGAATTCT CATCATCTCTGTAGACATCTCTGTGAGTGTCAGGTGTTGAGTGAACTCACCTTGTTCATCCAGTTCCAGT GCAGACTCGGGGGCTCATCATACAGAGCAGGTCTGTTCTGACTGCTGCAGCCGTCTCAGATTGGCTTTCA GGATGCGGTACACAGGGCTAATGGGAACACTGCTCACCTTGGTCAACCTGCTGCAGCTGGCTGGGACTCT GAGAATTGCAGCCTTCAACATTCGGACTTTTGGGGAGACTAAGATGTCCAATGCTACCCTCTCTGTATAC TTTGTGAAAATCCTGAGTCGCTATGACATCGCTGTTATCCAAGAGGTCAGAGACTCCCACCTGGTTGCTG TTGGGAAGCTCCTGGATGAACTCAATCGGGACAAACCTGACACCTACCGCTATGTAGTCAGTGAGCCGCT GGGCCGTAAAAGCTACAAGGAACAGTACCTTTTTGTGTACAGGCCTGACCAGGTGTCTATTCTGGACAGC TATCAATATGATGATGGCTGTGAACCCTGTGGAAATGACACCTTCAGCAGAGAGCCAGCCATTGTTAAGT TCTTTTCCCCATACACTGAGGTCCAAGAATTTGCGATCGTGCCCTTGCATGCAGCCCCAACAGAAGCTGT GAGTGAGATCGACGCCCTCTACGATGTTTACCTAGATGTCTGGCAAAAGTGGGGCCTGGAGGACATCATG TTCATGGGAGACTTCAATGCTGGCTGCAGCTACGTCACTTCCTCCCAGTGGTCCTCCATTCGCCTTCGGA CAAGCCCCATCTTCCAGTGGCTGATCCCTGACAGTGCGGACACCACAGTCACATCAACACACTGTGCTTA TGACAGGATTGTGGTTGCTGGAGCTCTGCTCCAGGCTGCTGTTGTTCCCAACTCGGCTGTTCCTTTTGAT TTCCAAGCAGAATACAGACTTTCCAACCAGCTGGCTGAAGCCATCAGTGACCATTACCCAGTGGAGGTGA CACTCAGAAAAATCTGATGTCATTGAGCAGTTCAGCCATACTGCTTCTGGTGAGGAAGAATCCACTTCAA CTCTATTTGGTACTACAGCATTCCACCATCTCGCAACAGAGAAAACGTCTGCCACGGGCGCTAAGAAATA CTGTTTAATTGAAGTAAATAAAGGAGAGCTCAAGCAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI |
ACCN NM_010061
Insert Size 855 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC014718, AAH14718
RefSeq Size 1312 bp
RefSeq ORF 855 bp
Locus ID 13419
UniProt ID P49183
Cytogenetics 16 2.37 cM
Summary Serum endocuclease secreted into body fluids by a wide variety of exocrine and endocrine organs (PubMed:29191910). Expressed by non-hematopoietic tissues and preferentially cleaves protein-free DNA. Among other functions, seems to be involved in cell death by apoptosis. Binds specifically to G-actin and blocks actin polymerization (By similarity). Together with DNASE1L3, plays a key role in degrading neutrophil extracellular traps (NETs) (PubMed:29191910). NETs are mainly composed of DNA fibers and are released by neutrophils to bind pathogens during inflammation (PubMed:29191910). Degradation of intravascular NETs by DNASE1 and DNASE1L3 is required to prevent formation of clots that obstruct blood vessels and cause organ damage following inflammation (PubMed:29191910).UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_010061" in other vectors (4)
SKU Description Size Price
MG203857 Dnase1 (tGFP-tagged) - Mouse deoxyribonuclease I (Dnase1) 10 ug
$500.00
MR203857 Dnase1 (Myc-DDK-tagged) - Mouse deoxyribonuclease I (Dnase1) 10 ug
$289.00 $300.00
MR203857L3 Lenti ORF clone of Dnase1 (Myc-DDK-tagged) - Mouse deoxyribonuclease I (Dnase1) 10 ug
$600.00
MR203857L4 Lenti ORF clone of Dnase1 (mGFP-tagged) - Mouse deoxyribonuclease I (Dnase1) 10 ug
$600.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products