OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Pparg (NM_011146) Mouse Untagged Clone

Be the first to review this product
SKU
MC201042
Pparg (untagged) - Mouse peroxisome proliferator activated receptor gamma (Pparg), transcript variant 2, (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $471.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Pparg or NM_011146"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Pparg
Synonyms Nr1; Nr1c3; PPA; PPAR; Ppar-; PPAR-gamma; PPAR-gamma2; PPARgamma; PPARgamma2
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC021798 sequence for NM_011146
CAAAACACCAGTGTGAATTACAGCAAATCTCTGTTTTATGCTGTTATGGGTGAAACTCTGGGAGATTCTC CTGTTGACCCAGAGCATGGTGCCTTCGCTGATGCACTGCCTATGAGCACTTCACAAGAAATTACCATGGT TGACACAGAGATGCCATTCTGGCCCACCAACTTCGGAATCAGCTCTGTGGACCTCTCCGTGATGGAAGAC CACTCGCATTCCTTTGACATCAAGCCCTTTACCACAGTTGATTTCTCCAGCATTTCTGCTCCACACTATG AAGACATTCCATTCACAAGAGCTGACCCAATGGTTGCTGATTACAAATATGACCTGAAGCTCCAAGAATA CCAAAGTGCGATCAAAGTAGAACCTGCATCTCCACCTTATTATTCTGAAAAGACCCAGCTCTACAACAGG CCTCATGAAGAACCTTCTAACTCCCTCATGGCCATTGAGTGCCGAGTCTGTGGGGATAAAGCATCAGGCT TCCACTATGGAGTTCATGCTTGTGAAGGATGCAAGGGTTTTTTCCGAAGAACCATCCGATTGAAGCTTAT TTATGATAGGTGTGATCTTAACTGCCGGATCCACAAAAAAAGTAGAAATAAATGTCAGTACTGTCGGTTT CAGAAGTGCCTTGCTGTGGGGATGTCTCACAATGCCATCAGGTTTGGGCGGATGCCACAGGCCGAGAAGG AGAAGCTGTTGGCGGAGATCTCCAGTGATATCGACCAGCTGAACCCAGAGTCTGCTGATCTGCGAGCCCT GGCAAAGCATTTGTATGACTCATACATAAAGTCCTTCCCGCTGACCAAAGCCAAGGCGAGGGCGATCTTG ACAGGAAAGACAACGGACAAATCACCATTTGTCATCTACGACATGAATTCCTTAATGATGGGAGAAGATA AAATCAAGTTCAAACATATCACCCCCCTGCAGGAGCAGAGCAAAGAGGTGGCCATCCGAATTTTTCAAGG GTGCCAGTTTCGATCCGTAGAAGCCGTGCAAGAGATCACAGAGTATGCCAAAAATATCCCTGGTTTCATT AACCTTGATTTGAATGACCAAGTGACTCTGCTCAAGTATGGTGTCCATGAGATCATCTACACGATGCTGG CCTCCCTGATGAATAAAGATGGAGTCCTCATCTCAGAGGGCCAAGGATTCATGACCAGGGAGTTCCTCAA AAGCCTGCGGAAGCCCTTTGGTGACTTTATGGAGCCTAAGTTTGAGTTTGCTGTGAAGTTCAATGCACTG GAATTAGATGACAGTGACTTGGCTATATTTATAGCTGTCATTATTCTCAGTGGAGACCGCCCAGGCTTGC TGAACGTGAAGCCCATCGAGGACATCCAAGACAACCTGCTGCAGGCCCTGGAACTGCAGCTCAAGCTGAA TCACCCAGAGTCCTCTCAGCTGTTCGCCAAGGTGCTCCAGAAGATGACAGACCTCAGGCAGATCGTCACA GAGCACGTGCAGCTACTGCATGTGATCAAGAAGACAGAGACAGACATGAGCCTTCACCCCCTGCTCCAGG AGATCTACAAGGACTTGTATTAGCAGGAAAGTCCCACCCGCTGACAACGTGTTCCTTCTATTGATTGCAC TATTATTTTGAGGGAAAAAAATCTGACACCTAAGAAATTTACTGTGAAAAAGCATTTAAAAACAAAAAGT TTTAGAACATGATCTATTTTATGCATATTGTTTATAAAGATACATTTACAATTTACTTTTAATATTAAAA ATTACCCCCTTATAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI |
ACCN NM_011146
Insert Size 1518 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC021798, AAH21798
RefSeq Size 1782 bp
RefSeq ORF 1518 bp
Locus ID 19016
UniProt ID P37238
Cytogenetics 6 53.41 cM
Summary This gene encodes a nuclear receptor protein belonging to the peroxisome proliferator-activated receptor (Ppar) family. The encoded protein is a ligand-activated transcription factor that is involved in the regulation of adipocyte differentiation and glucose homeostasis. The encoded protein forms a heterodimer with retinoid X receptors and binds to DNA motifs termed "peroxisome proliferator response elements" to either activate or inhibit gene expression. Mice lacking the encoded protein die at an embryonic stage due to severe defects in placental vascularization. When the embryos lacking this gene are supplemented with healthy placentas, the mutants survive to term, but succumb to lipodystrophy and multiple hemorrhages. Alternative splicing results in multiple transcript variants encoding different isoforms. provided by RefSeq, Apr 2015
Transcript Variant: This variant (2) encodes the longer isoform (2). Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript from the same strain was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_011146" in other vectors (4)
SKU Description Size Price
MG208132 Pparg (tGFP-tagged) - Mouse peroxisome proliferator activated receptor gamma (Pparg) 10 ug
$489.00 $670.00
MR208132 Pparg (Myc-DDK-tagged) - Mouse peroxisome proliferator activated receptor gamma (Pparg), transcript variant 2 10 ug
$289.00 $470.00
MR208132L3 Lenti ORF clone of Pparg (Myc-DDK-tagged) - Mouse peroxisome proliferator activated receptor gamma (Pparg), transcript variant 2 10 ug
$770.00
MR208132L4 Lenti ORF clone of Pparg (mGFP-tagged) - Mouse peroxisome proliferator activated receptor gamma (Pparg), transcript variant 2 10 ug
$770.00

file-alt Citations

Identification of PTGR2 inhibitors as a new therapeutic strategy for diabetes and obesity
Chang, Hsieh, Lee et al
EMBO Mol Med (2025)
Cited by 4
AI Summary: OriGene’s Recombinant DNA Murine PPARγ plasmid (Cat.# MC201042) was used in this study to investigate the molecular mechanisms of PPARγ activation and its role in glucose homeostasis and obesity.
Snippet: Recombinant DNA Murine PPARγ plasmid OriGene, USA Cat.# MC201042 Gal4-PPARγ plasmid were generously provided by R. M. Evans (Howard Hughes Medical Institute, The Salk Institute for Biological Studies, La Jolla, CA) N/A
Increasing endogenous PPARγ ligands improves insulin sensitivity and protects against diet-induced obesity without side effects of thiazolidinediones
Tseng, Chuang, Chang et al
Research Square (2021)
Cited by 2
Snippet: Plasmid construction and site-directed mutagenesis Murine PPARγ plasmid (pCMV6-Pparg) was purchased from OriGene (cat. no. MC201042, OriGene, USA). A cysteine-313 to alanine (C313A) substitution of mPPARγ construct was generated with the Page
Evaluation of Teneligliptin Effects on Transcriptional Activity of PPARγ in Cell-Based Assays
Takenaka, Inoue, Nakano et al
J Nippon Med Sch (2018) 85 (2), 95-101 DOI: 10.1272/jnms.2018_85-15
AI Summary: OriGene’s mouse Pparγ2 cDNA clone (MC201042) in pCMV6-Kan/Neo was used to overexpress PPARγ2 in cells, enabling the study of teneligliptin’s effects on PPARγ transcriptional activity.
Snippet: pGL3-Promoter-PPRE (Fig. 1 B). We overexpressed PPARγ2 without an epitope tag us- ing a cDNA clone (MC201042) harboring full-length mouse Pparγ2 cDNA in pCMV6-Kan/Neo (OriGene). Other cDNAs encoding mouse
Evaluation of Teneligliptin Effects on Transcriptional Activity of PPARγ in Cell-Based Assays
Takenaka, Inoue, Nakano
EBSCO (2018)
Snippet: pGL3-Promoter-PPRE (Fig. 1 B). We overexpressed PPARγ2 without an epitope tag us- ing a cDNA clone (MC201042) harboring full-length mouse Pparγ2 cDNA in pCMV6-Kan/Neo (OriGene). Other cDNAs encoding mouse
Showing 1-4 of 4 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products