OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Med7 (NM_025426) Mouse Untagged Clone

Be the first to review this product
SKU
MC201011
Med7 (untagged) - Mouse mediator complex subunit 7 (Med7), transcript variant 1, (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Med7 or NM_025426"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Med7
Synonyms 1110063B05Rik; Crsp9; Crsp33
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC011333 sequence for NM_025426
GAAAAGTCACTACCGGAAAAGCAAGAAAGAGCTGAGGTGAGCGGGCGGCGGCGGTTGGCGACCGCAGCCT AAGTCTGTCTCTCCGCCCCCGCGGTTGCGTCTCTCCCGGCGTGGAGCGCCGAAGTCCGGCGCGGGACAGC CTGGGACGCCCGGGCTAGCCTTCCTCCCGGTTCCTCCGCGAAGCCTCCCCGGGGCCTGAGGCAGGCGGCC GGCCGAAGGATCATCTGTCCCTATCGGGTGAGTTAGCACACCTGTTGTCTTGGGTGGTCAACACGTTCTC AATTTTCAAGGTGTATTTCCTATCAGGAAACTTGAAGATAATACGGTCTGAACCCACAGTGAACTTCTGA ACATCGTAGTTGTGTTGATCAGGCTGCTCTGGTCTTAGGTTCTTGATTGTCTACAATGGGTGAACCACAG CAAGTGAGTGCACTTCCACCGCCTCCAATGCAGTACATCAAGGAATATACAGATGAAAATAGTCAGGAAG GCTTGGCTCCAGGCCGACCTCCTCCAATTAAAGACAGCTACATGATGTTTGGCAACCAGAAGCGATGTGA TGATCTTATCATTCGCCCTTTAGAAAGTCAGGGCATTGAACGGCTTCATCCTATGCAATTTGATCATAAG AAAGAGCTGAGAAAACTCAATATGTCTATACTGATTAATTTCTTAGACCTTTTAGACATCTTAATAAGAA GTCCTGGGAGTATAAAACGAGAAGAAAAGCTAGAAGATCTTAAGCTACTTTTTGTACATGTACATCATCT TATAAATGAATATCGACCCCACCAAGCAAGAGAGACTTTGAGAGTCATGATGGAGGTCCAGAAACGCCAG CGCCTTGAAACAGCTGAGAGGTTTCAGAAACATCTGGAACGAGTCATTGAAATGATTCAGAATTGCTTGG CTTCTTTGCCCGATGATTTGCCCCATTCAGAAGCAGGGATGAGAGTTAAAGCTGAGCCGATGGATACTGA TGATAACAGCAATTGTCCTGGACAGAATGAACAACAAAGAGAAAGTTCAGGTCACAGAAGGGACCAGATT ATAGAAAAAGATGCTGCCTTATGTGTGCTAATTGATGAAATGAATGAAAGGCCATGAAGAATATTCCTTT TTTTCCTTTTAGTAAGTAGCATCATATATTAGTTTATTTCCTCTCAGACAGTCTTAAGAGGTATAACTAA AGATACTAAGAGACTTTTTTTCAATTGAAATGCTGTAGGTGGTAATTTAACACTAAACATAGGCCAGCAA GTATATTTGAGTAATTGCCTTAAAAAAGCTGAATGTTTGCTATTGTTTGAGATAGTCCTATTTTTTGGAG TTGGAATAAAAACTTGAAGTAATAACGAATTGTCATTCTTGGAAAAAAAGTTATTTGCTTCGAGACTAAT AAAGGGCATCAAGTGTAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI |
ACCN NM_025426
Insert Size 702 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC011333, AAH11333
RefSeq Size 1432 bp
RefSeq ORF 702 bp
Locus ID 66213
UniProt ID Q9CZB6
Cytogenetics 11 B1.1
Summary Component of the Mediator complex, a coactivator involved in the regulated transcription of nearly all RNA polymerase II-dependent genes. Mediator functions as a bridge to convey information from gene-specific regulatory proteins to the basal RNA polymerase II transcription machinery. Mediator is recruited to promoters by direct interactions with regulatory proteins and serves as a scaffold for the assembly of a functional preinitiation complex with RNA polymerase II and the general transcription factors (By similarity).UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (1) represents the longest transcript. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_025426" in other vectors (4)
SKU Description Size Price
MG202821 Med7 (tGFP-tagged) - Mouse cofactor required for Sp1 transcriptional activation, subunit 9 (Crsp9) 10 ug
$500.00
MR202821 Med7 (Myc-DDK-tagged) - Mouse mediator complex subunit 7 (Med7), transcript variant 1 10 ug
$289.00 $300.00
MR202821L3 Lenti ORF clone of Med7 (Myc-DDK-tagged) - Mouse mediator complex subunit 7 (Med7), transcript variant 1 10 ug
$600.00
MR202821L4 Lenti ORF clone of Med7 (mGFP-tagged) - Mouse mediator complex subunit 7 (Med7), transcript variant 1 10 ug
$600.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products