OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Slc25a33 (NM_027460) Mouse Untagged Clone

Be the first to review this product
SKU
MC200938
Slc25a33 (untagged) - Mouse solute carrier family 25, member 33 (Slc25a33), nuclear gene encoding mitochondrial protein, (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Slc25a33 or NM_027460"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Slc25a33
Synonyms 5730438N18Rik; Pnc1
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC011293 sequence for NM_027460
GCGGCTGGAAAGCGCCGCAGAGGCCGCTGACTGGCCGGGCGCGACGCCGCGGAGGGAGCCGGGCGCCTGG GCCTCCCGCGCGCATGGGCGCGTCGGCGGCTGCCTGAGGAAGGCAGCGAAGCCAGCGGAGCTCGAGACCT CGCGCGTCCCACGAGCGGCTGCGGCGGGCCGCGGAGCCGGCGCGGCCATGGCGACGGGCACTCAGCAGAA AGAGAACACGCTGCTTCATCTCTTCGCCGGCGGGTGCGGGGGCACAGTTGGTGCTATTTTCACATGTCCA CTAGAAGTCATTAAGACGCGACTGCAGTCTTCGAGACTAGCTCTTCGGACGGTGTATTACCCTCAGGTTC ATCTGGGGACCATTAGTGGAGCTGGAATGGTGAGACCAACGTCTGTGACGCCTGGACTCCTACAGGTTCT GAAATCAATCCTGGAAAAGGAGGGACCAAAGTCACTCTTTAGAGGCCTGGGTCCAAATTTGGTTGGAGTT GCACCATCAAGGGCTGTGTACTTTGCATGTTATTCCAAAGCCAAAGAGCAATTCAATGGCGTCTTCGTGC CTAATAGCAATACTGTGCACATTCTCTCAGCTGGCTCTGCAGCTTTTGTCACAAATACCTTAATGAATCC TATTTGGATGGTTAAAACGAGGATGCAGCTAGAACGCAAGGTGAGGGGCTGCAAGCAGATGAACACACTC CAGTGTGCTCGGCGTGTCTACCAGACAGAAGGCGTCCGCGGCTTCTATAGAGGGCTGACCGCCTCCTACG CTGGGATCTCGGAGACAATCATCTGCTTTGCTATTTATGAGAGCTTAAAGAAGTGTTTGAAAGACGCTCC GATCGTCTCCTCCACAGATGGAGCTGAGAAAAGTTCCTCTGGCTTCTTTGGACTCATGGCAGCTGCTGCT GTTTCTAAGGGATGTGCCTCCTGCATCGCTTACCCACACGAGGTCATCAGGACGCGGCTCCGCGAGGAAG GCAGCAAGTACAGGTCCTTCGTGCAGACCGCGCGCCTGGTGTTCCGGGAGGAAGGCTACCTCGCCTTCTA CCGAGGACTGTTTGCTCAGCTCATCCGGCAGATCCCCAACACTGCCATTGTCCTGTCCACCTACGAGTTC ATCGTGTACCTGCTGGGAGAGCGTGCTTAGTGACAGGGCCACATGATTGTGCTCTAGAAGAATAAAACCG AAAACCCTAGAGATTTTCTTTTCCGTTGATGTTTAGTGTTCAAAACTGAAACAGTGAAGGCCATAGAATA CCTGGCTCATGTCACCTGTTGGACATTTCCTTTTGGATTCTTGTTTCTGGAAGGTTGAAATTCATTAACG TTAATAGTTAATTATAACTTTCTTTTTTAACTTAAGAGGACTGAGGATTGAGGAGCAAGTAAATTAAATC ATGCTATTTAATGTAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI |
ACCN NM_027460
Insert Size 963 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC011293, AAH11293
RefSeq Size 1433 bp
RefSeq ORF 963 bp
Locus ID 70556
UniProt ID Q3TZX3
Cytogenetics 4 E2
Summary Mitochondrial transporter that imports/exports pyrimidine nucleotides into and from mitochondria. Transports preferentially uracil, thymine, and cytosine (deoxy)nucleoside di- and triphosphates by an antiport mechanism. Also transports guanine but not adenine (deoxy)nucleotides. Is inhibited strongly by pyridoxal 5'-phosphate, 4,7-diphenyl-1,10-phenanthroline, tannic acid, and mercurials (mercury dichloride, mersalyl acid, p-hydroxymercuribenzoate). Participates in mitochondrial genome maintenance, regulation of mitochondrial membrane potential and mitochondrial respiration (By similarity). Upon INS or IGF1 stimulation regulates cell growth and proliferation by controlling mitochondrial DNA replication and transcription, the ratio of mitochondria-to nuclear-encoded components of the electron transport chain resulting in control of mitochondrial ROS production (PubMed:17596519). Participates in dendritic cell endocytosis and may associate with mitochondrial oxidative phosphorylation (By similarity).UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_027460" in other vectors (4)
SKU Description Size Price
MG205182 Slc25a33 (tGFP-tagged) - Mouse solute carrier family 25, member 33 (Slc25a33) 10 ug
$489.00 $500.00
MR205182 Slc25a33 (Myc-DDK-tagged) - Mouse solute carrier family 25, member 33 (Slc25a33), nuclear gene encoding mitochondrial protein 10 ug
$289.00 $300.00
MR205182L3 Lenti ORF clone of Slc25a33 (Myc-DDK-tagged) - Mouse solute carrier family 25, member 33 (Slc25a33), nuclear gene encoding mitochondrial protein 10 ug
$600.00
MR205182L4 Lenti ORF clone of Slc25a33 (mGFP-tagged) - Mouse solute carrier family 25, member 33 (Slc25a33), nuclear gene encoding mitochondrial protein 10 ug
$600.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products