Agr2 (NM_011783) Mouse Untagged Clone

SKU
MC200841
Agr2 (untagged) - Mouse anterior gradient 2 (Xenopus laevis) (Agr2), (10ug)
  $300.00
In Stock*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Agr2
Synonyms Agr2h; Gob-4; HAG-2; mAG-2; XAG-2
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC013334 sequence for NM_011783
CCACGCGTCCGCTTGGACGGCAACCCTTGCGGCTCACACAAAGCAGGAGGGTGGGAAGCCCAGATTTGCC ATGGAGAAATTTTCAGTGTCTGCAATCCTGCTTCTTGTGGCCATTTCTGGTACCTTGGCCAAAGACACCA CAGTCAAATCTGGAGCCAAAAAGGACCCAAAGGACTCTCGGCCCAAACTACCTCAGACACTCTCCAGAGG TTGGGGCGATCAGCTCATCTGGACTCAGACATACGAAGAAGCTTTATACAGATCCAAGACAAGCAACAGA CCCTTGATGGTCATTCATCACTTGGACGAATGCCCACACAGTCAAGCCTTAAAGAAAGTGTTTGCTGAAC ATAAAGAAATCCAGAAATTGGCAGAGCAGTTTGTTCTCCTCAACCTGGTCTATGAAACAACCGACAAGCA CCTTTCTCCTGATGGCCAGTACGTCCCCAGAATTGTGTTTGTAGACCCATCCCTGACGGTGAGGGCAGAC ATCACTGGACGATACTCAAACCGGCTCTACGCTTATGAACCTTCTGACACAGCTTTGTTGTACGACAACA TGAAGAAAGCTCTCAAGCTGCTAAAGACAGAATTGTAGAGCTAACTGCGCACCGGGTCAGGAGACCAGAA GGCAGAAGCACTGTGGACTTGCAGATTACAGTACAGTTTAATGTTACAACAGATATATTTTTTAAACACC CACAGGTGGGGAAACAATATTATTATCTACTACAGTGAAGCATGATTTTCTAGAAAATAAAGTCTTGTGA GAACTCCAGCTGAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI |
ACCN NM_011783
Insert Size 528 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC013334, AAH13334
RefSeq Size 802 bp
RefSeq ORF 528 bp
Locus ID 23795
UniProt ID O88312
Cytogenetics 12 A3
Summary Required for MUC2 post-transcriptional synthesis and secretion. May play a role in the production of mucus by intestinal cells. Proto-oncogene that may play a role in cell migration, cell differentiation and cell growth (By similarity). Promotes cell adhesion (By similarity).UniProtKB/Swiss-Prot Function
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_011783" in other vectors (4)
SKU Description Size Price
MG201533 Agr2 (tGFP-tagged) - Mouse anterior gradient 2 (Xenopus laevis) (Agr2) 10 ug
$489.00 $500.00
MR201533 Agr2 (Myc-DDK-tagged) - Mouse anterior gradient 2 (Xenopus laevis) (Agr2) 10 ug
$289.00 $300.00
MR201533L3 Lenti ORF clone of Agr2 (Myc-DDK-tagged) - Mouse anterior gradient 2 (Xenopus laevis) (Agr2) 10 ug
$600.00
MR201533L4 Lenti ORF clone of Agr2 (mGFP-tagged) - Mouse anterior gradient 2 (Xenopus laevis) (Agr2) 10 ug
$600.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products