Rnase4 (NM_201239) Mouse Untagged Clone

SKU
MC200754
Rnase4 (untagged) - Mouse ribonuclease, RNase A family 4 (Rnase4), transcript variant 2, (10ug)
  $150.00
In Stock*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Rnase4
Synonyms C730049F20Rik; Rab1
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC005569 sequence for NM_201239
CAGGAAGGAAGGAGTGAAAAACAAAGCTGCCGCCTCCAGTTCCGGGTCCAGGCACTTTCTAGGTAATGAT GGATCTACAGAGGACTCAGTCCTTGCTTCTGCTCTTGGTGCTGACCCTGCTGGGGTTAGGGCTTGTACAG CCCTCCTATGGCCAGGATCGAATGTACCAACGGTTCCTTCGACAGCATGTGGACCCTCAGGCGACAGGTG GCAATGACAACTACTGCAACGTTATGATGCAGAGACGGAAGATGACTTCTGTCCAGTGCAAACGCTTCAA CACCTTCATCCACGAAGACATCTGGAACATTCGTGGCATCTGTAGTACCACCAATATCCTGTGCAAGAAC GGCCAGATGAACTGTCACGAAGGTGTAGTGAAGGTCACGGACTGCAGAGAGACAGGGAACTCCAAGGCCC CCAACTGTAGATACAGGGCAAGAACCAGCACTAGGCGAGTTGTCATTGCCTGTGAGGGTGACCCAGAGGT CCCAGTGCACTTTGACAGATAGATGCTATCCTGCAGCTGTTACAGCTGATAGTTGACCTCTGAGTCAGTG AGACCAACAATGAGTGGTGGCCCCAGGCTTTGTTTCCTTTGCTCGTGCCTTATACTCACATATATCCAAT ATAACCCATGGTGTTAAGCGCATCCCATCCAAGGGGAGAAAGAAGCCTGTGCTCACAGCACTGATGGCTT GGTTCTCCCAGATTCTATCCCCTGGAACTTATGCATTACATGTATTCAGATAGTATCTCAACGATTATAG AGAGCCTTTTCTGTCCAAGCTGTCTCATTCCAGTCCTCTAACACCCCTTGAGACCAATTCTGCCACTGTA TTTAGAAGCTTTGAGTTAAAGGATTTGATGACCACAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI |
ACCN NM_201239
Insert Size 447 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC005569, AAH05569
RefSeq Size 893 bp
RefSeq ORF 447 bp
Locus ID 58809
Cytogenetics 14 C1
Summary This gene encodes a member of the pancreatic ribonuclease A superfamily. The encoded enzyme is sereted and has unique uridine specificity. This gene resides in a cluster of highly related genes. It shares dual promoters and 5' exons with the angiogenin, ribonuclease, RNase A family, 5 gene. Each gene splices to a unique downstream exon that contains its complete coding region. Two alternatively spliced variants, with different 5' exons but the same coding exon, have been identified. provided by RefSeq, Jun 2009
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_201239" in other vectors (4)
SKU Description Size Price
MG201018 Rnase4 (tGFP-tagged) - Mouse ribonuclease, RNase A family 4 (Rnase4), transcript variant 2 10 ug
$489.00
MR201018 Rnase4 (Myc-DDK-tagged) - Mouse ribonuclease, RNase A family 4 (Rnase4), transcript variant 2 10 ug
$289.00
MR201018L3 Lenti ORF clone of Rnase4 (Myc-DDK-tagged) - Mouse ribonuclease, RNase A family 4 (Rnase4), transcript variant 2 10 ug
$450.00
MR201018L4 Lenti ORF clone of Rnase4 (mGFP-tagged) - Mouse ribonuclease, RNase A family 4 (Rnase4), transcript variant 2 10 ug
$450.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products