OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Mrto4 (NM_023536) Mouse Untagged Clone

Be the first to review this product
SKU
MC200549
Mrto4 (untagged) - Mouse MRT4 turnover 4, homolog (S. cerevisiae) (Mrto4), mRNA, (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Mrto4 or NM_023536"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Mrto4
Synonyms 2610012O22Rik; Mg684; Mrt4
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC005734 sequence for NM_023536
CGATGCCCAAATCCAAGCGAGACAAGAAAGTTTCTTTAACAAAAACTGCCAAGAAAGGCTTGGAACTGAA GCAGAACCTGATAGAAGAGCTTCGGAAATGTGTGGACACCTACAAGTACCTTTTCATCTTCTCTGTGGCC AACATGAGGAACAGCAAGCTGAAAGACATCCGGAACGCCTGGAAACACAGCCGGATGTTCTTTGGCAAAA ACAAGGTGATGATGGTGGCCTTGGGTCGAAGCCCATCTGATGAATACAAAGACAACCTACATCAGGTCAG CAAGAAGTTGAGAGGTGAAGTTGGGCTGCTGTTTACCAACCGCACGAAGGAGGAGGTGAATGAGTGGTTC ACCAAGTATACAGAAATGGATTTTGCTCGAGCGGGGAACAAAGCAACTCTAACTGTGAGCCTGGATCCAG GGCCCCTGAAGCAATTCCCTCACTCCATGGAGCCACAGCTGAGGCAGCTGGGGCTGCCCACTGCCCTCAA GAAAGGTGTGGTGACCCTGCTGTCTGACTATGAAGTATGCAAAGAGGGTGACGTGCTGACCCCAGAGCAG GCCCGTATCCTGCTGTTTGGGTATGAGATGGCTGAATTCAAAGTGATCATCAAATACATGTGGGACGCCC AGTCAGGACGATTCCAGCAGATGGACGATGACCTGCCTGAGAGCGCGCCTGAGTCTGAGGGAGAGTCTGA GGAGGAGGATGACAGCTGACTCTGAGAGCCAGGACTATGGCCTTCCAGCGAGTTCTTCATCTTTGCTGGA CACCCCACCCCACCTCACCCTGCCCCCGGACTGCTGTCACCACTCTAGAGGGAACAGCTATTTATTTTGC TATGGACAAAGACAAGGGAGGGTGCTAGGGAATGATTTTGTTTCTATAAAGAATAAAATTGTGTCCGCGG GGTGTTCCCGGGAGACAGCAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI |
ACCN NM_023536
Insert Size 717 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC005734, AAH05734
RefSeq Size 954 bp
RefSeq ORF 717 bp
Locus ID 69902
UniProt ID Q9D0I8
Cytogenetics 4 D3
Summary Component of the ribosome assembly machinery. Nuclear paralog of the ribosomal protein P0, it binds pre-60S subunits at an early stage of assembly in the nucleolus, and is replaced by P0 in cytoplasmic pre-60S subunits and mature 80S ribosomes.UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 3' coding region, compared to variant 1. It encodes isoform 2, which is shorter by an amino acid, compared to isoform 1.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_023536" in other vectors (4)
SKU Description Size Price
MG202929 Mrto4 (tGFP-tagged) - Mouse MRT4 turnover 4, homolog (S. cerevisiae) (Mrto4), mRNA 10 ug
$500.00
MR202929 Mrto4 (Myc-DDK-tagged) - Mouse MRT4 turnover 4, homolog (S. cerevisiae) (Mrto4), mRNA 10 ug
$289.00 $300.00
MR202929L3 Lenti ORF clone of Mrto4 (Myc-DDK-tagged) - Mouse MRT4 turnover 4, homolog (S. cerevisiae) (Mrto4), mRNA 10 ug
$600.00
MR202929L4 Lenti ORF clone of Mrto4 (mGFP-tagged) - Mouse MRT4 turnover 4, homolog (S. cerevisiae) (Mrto4), mRNA 10 ug
$600.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products