Prmt1 (BC002249) Mouse Untagged Clone

SKU
MC200097
Prmt1 (untagged) - Mouse protein arginine N-methyltransferase 1 (cDNA clone MGC:7572 IMAGE:3493263), (10ug)
  $457.00
In Stock*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Prmt1
Synonyms 6720434D09Rik; AW214366; Hrmt1l2; Mrmt1
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC002249
GCAGCCGAGGCCGCGAACTGCATCATGGAGGTTTCCTGTGGCCAAGCAGAAAGTAGTGAGAAGCCCAACG CTGAGGACATGACATCCAAAGACTACTACTTTGACTCCTATGCCCACTTTGGCATCCACGAGGAGATGCT GAAGGATGAGGTGCGCACCCTCACATACCGCAACTCCATGTTTCACAATCGGCATCTCTTCAAAGACAAG GTGGTGCTGGACGTGGGCTCAGGCACTGGCATCCTCTGCATGTTTGCTGCCAAGGCGGGGGCCCGCAAGG TTATTGGGATTGAGTGTTCCAGTATCTCCGATTATGCTGTGAAGATTGTCAAAGCCAACAAGTTAGACCA TGTGGTGACCATCATCAAGGGCAAGGTGGAGGAGGTGGAGCTGCCCGTGGAGAAGGTGGACATCATCATC AGCGAGTGGATGGGTTACTGCCTCTTCTACGAGTCCATGCTCAACACCGTGCTGCATGCTCGGGACAAGT GGCTGGCACCCGATGGCCTCATCTTCCCAGACCGGGCCACCTTGTATGTGACAGCCATTGAGGACCGACA ATATAAAGACTACAAGATCCACTGGTGGGAGAACGTGTATGGCTTTGATATGTCCTGCATTAAAGACGTG GCCATCAAGGAGCCCCTGGTGGACGTGGTGGACCCAAAGCAGCTGGTCACCAATGCCTGCCTCATAAAGG AGGTGGACATCTACACAGTCAAGGTGGAGGACCTGACCTTCACCTCCCCCTTCTGCCTGCAAGTGAAGAG GAACGACTACGTGCATGCGTTGGTGGCTTACTTCAACATCGAGTTCACCCGATGCCACAAGAGGACCGGC TTCTCCACCAGTCCTGAGTCCCCGTACACACACTGGAAGCAGACTGTGTTCTACATGGAGGACTACCTAA CAGTGAAGACTGGCGAGGAGATCTTTGGCACCATTGGAATGAGGCCCAATGCCAAAAACAATCGTGACTT GGACTTTACCATCGACCTGGACTTCAAGGGTCAGCTGTGTGAGCTCTCTTGTTCCACCGACTACCGGATG CGCTGAGGAGGTGCCAGGCTGGCCCTCCTGCAGAAGGGGGCTCGGGGGGATGGGCTTGGGGGATGGGGGG GTACATCGTGACTGTGTTTTTCATAACTTATGTTTTTATATGGTTGCGTTTATGCCAATAAATCCTCAGC TGACCATGAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI |
ACCN BC002249
Insert Size 1032 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC002249, AAH02249
RefSeq Size 1213 bp
RefSeq ORF 1032 bp
Locus ID 15469
Cytogenetics 7 29.07 cM
Summary Arginine methyltransferase that methylates (mono and asymmetric dimethylation) the guanidino nitrogens of arginyl residues present in proteins such as ESR1, histone H2, H3 and H4, ILF3, HNRNPA1, HNRNPD, NFATC2IP, SUPT5H, TAF15, EWS, HABP4 and SERBP1 (PubMed:15327772, PubMed:19858291). Constitutes the main enzyme that mediates monomethylation and asymmetric dimethylation of histone H4 'Arg-4' (H4R3me1 and H4R3me2a, respectively), a specific tag for epigenetic transcriptional activation (By similarity). Methylates H4R3 in genes involved in glioblastomagenesis in a CHTOP- and/or TET1-dependent manner (By similarity). May be involved in the regulation of TAF15 transcriptional activity, act as an activator of estrogen receptor (ER)-mediated transactivation, play a key role in neurite outgrowth and act as a negative regulator of megakaryocytic differentiation, by modulating p38 MAPK pathway (By similarity). Methylates RBM15, promoting ubiquitination and degradation of RBM15 (By similarity). Methylates CHTOP and this methylation is critical for its 5-hydroxymethylcytosine (5hmC)-binding activity (PubMed:19858291).UniProtKB/Swiss-Prot Function
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"BC002249" in other vectors (4)
SKU Description Size Price
MG205164 Prmt1 (tGFP-tagged) - Mouse protein arginine N-methyltransferase 1 (cDNA clone MGC:7572 IMAGE:3493263) 10 ug
$657.00
MR205164 Prmt1 (Myc-DDK-tagged) - Mouse protein arginine N-methyltransferase 1 (cDNA clone MGC:7572 IMAGE:3493263) 10 ug
$289.00 $457.00
MR205164L3 Lenti ORF clone of Prmt1 (Myc-DDK-tagged) - Mouse protein arginine N-methyltransferase 1 (cDNA clone MGC:7572 IMAGE:3493263) 10 ug
$757.00
MR205164L4 Lenti ORF clone of Prmt1 (mGFP-tagged) - Mouse protein arginine N-methyltransferase 1 (cDNA clone MGC:7572 IMAGE:3493263) 10 ug
$757.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products