pGFP-A-shAAV shRNA Vector

Snippet: A Opn3 short hairpin RNA (shRNA) (GGGACAGGCCAAAGAAGAAAG) and a non-targeting shRNA sequence (AATTCTCCGAACGTGTCACGT),23 used as a control, were cloned into HuSH shRNA GFP AAV Cloning Vector (pGFP-A-shAAV Vector;TR30034, Origene). The efficiency of the specific Opn3 shRNA was tested in HEK293T/17 cells (human embryonic kidney cell line, CRL-11268, ATCC) transiently overexpressing rat Opn3. …

Snippet: (1 ng/well, Promega, E2261). Samples were collected 48 h post transfection. 2.7 Virus production and validation Creb3l1 and non-targeting short hairpin RNAs (shRNAs) were cloned into pGFP-A-shAAV (OriGene, TR30034) as previously described [20]. We generated adeno-associated viruses (AAVs) expressing GFP and Creb3l1CA directed by a 2 kb fragment of the rat Avp promoter. AAV particles (AAV1/2) w

Snippet: … Dyrk1b AAV-shRNA production. The plasmids containing scrambled shRNA and 4 Dyrk1b shRNAs were purchased from Origene Inc. (catalog TL514285) and shuttled into the AAV vector with U6 promoter and inverse terminal repeats (Origene Inc., TR30034). The sequences of the Dyrk1b shRNAs and scrambled shRNA are repor;Dyrk1b AAV-shRNA production: The plasmids containin scrambled shRNA and four Dyrk1b 11 shRNAs was purchased from Origene Inc. (Catalog # TL514285) and shuttled into the AAV vector 12 with U6 promoter and Inverse terminal repeats, (Origene Inc., Catalog # TR30034). The 13 sequences of the Dyrk1b shRNAs and scrambled shRNA are reported in STable2. …

Snippet: Skip to article;pGFP-A-shAAV Origene Cat#TR30034 pLV-Kal-7 mCherry [NM_001164268.1] VectorBuilder VB181102-1224vxt

Snippet: Introduction of viral vectors into the SON The Creb3l1 and non-targeting short hairpin RNAs (shRNAs, supplemental table 1) were cloned into pGFP-A-shAAV (ORIGENE). Adeno-associated viral particles (AAV1/2) were produced using a helper;- Introduction of viral vectors into the SON The Creb3l1 and non-targeting short hairpin RNAs (shRNAs, supplemental table 1) were cloned into pGFP-A-shAAV (ORIGENE). …