OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

pGFP-B-RS shRNA Vector

Be the first to review this product
SKU
TR30018
HuSH shRNA GFP Retroviral Cloning Vector with blasticidin resistance (pGFP-B-RS Vector) 5 ug
  $670.00
In Stock*

Frequently Bought Together (1)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
Specifications
Specifications
Product Data
Control Type Negative
Fluorescent Label GFP
Mammalian Cell Selection Blasticidin
Viral Packaging Retroviral
Features
  • The HuSH pGFP-B-RS plasmid vector offers the same elements as pGFP-V-RS vector with an exception of an alternative mammalian selection marker. The substitute feature of using blasticidin selection instead of puromycin, which is available in all of our retroviral vectors assists researcher in creating stable cell lines in double knockdown experiment.
  • U6_F Primer can be used to sequence the target sequence after cloning.
Download Vector Sequence
Components 1 vial of 5 ug lyophilized pGFP-B-RS shRNA cloning vector
Quality Control This vector was sequence verified and functionally validated.
Storage Store the vector DNA at -20°C.
Stability Vector DNA is stable for at least one year from date of receipt when stored at -20°C.
Shipping Blue Ice
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

Annexin A2 (ANXA2) regulates the transcription and alternative splicing of inflammatory genes in renal tubular epithelial cells
Chen, Liu, Xia et al
BMC Genomics (2022) 23 (1), 544 DOI: 10.1186/s12864-022-08748-6
Cited by 16
AI Summary: OriGene’s pGFP-B-RS vector was used for cloning and delivering shRNA to achieve ANXA2 knockdown in HK2 cells, enabling the study of ANXA2’s role in regulating transcription and alternative splicing of inflammatory genes.
Snippet: shRNA) was designed using the free software OptiRNA. The silence sequence was TGAGGGTGACGTTAGCATTAC and was synthesized by TianyiHuiyuan Biotechnology Co., LTD (Beijing, China). The vector pGFP-B-RS (OriGene, Rockville, MD, USA) was digested using HindIII (NEB, Beijing, China) and BamHI (NEB, Beijing, China) and purified with a Qiagen column kit (Qiagen, Dusseldorf, Germany). Sense and antisense s
FigureFigureFigure
Nuclear respiratory factor-1 negatively regulates TGF-β1 and attenuates pulmonary fibrosis
Suliman, Healy, Zobi et al
iScience (2021) 25 (1), 103535 DOI: 10.1016/j.isci.2021.103535
Cited by 18
AI Summary: OriGene products, including siRNAs targeting HMOX1 (TR30018), CCN5 (TF511452), NRF-1 (TF517273), and the HO-1 TrueORF plasmid, were used to manipulate gene expression in human lung fibroblasts, enabling the study of molecular pathways involved in pulmonary fibrosis in this paper.
Snippet: C57BL/6NJ Jackson Laboratory Stock No. 000664 HO-1CKO This paper Suliman et al. (2017) ------------------------- Oligonucleotides ------------------------- siRNA targeting HMOX1 Origene TR30018 siRNA targeting CCN5 Origene TF511452 siRNA targeting NRF-1 Origene TF517273 ------------------------- Recombinant DNA ------------------------- HO-1 TrueORF Origen
Myosin-1c promotes E-cadherin tension and force-dependent recruitment of α-actinin to the epithelial cell junction
Kannan, Tang
J Cell Sci (2018) 131 (12) DOI: 10.1242/jcs.211334
Cited by 28
AI Summary: OriGene products, specifically the Myosin-1c shRNA plasmids (cat# TG313128) and Myosin-1c antibody (cat# TA324949), were used in this study to knock down Myosin-1c expression and detect its protein levels, enabling the authors to investigate Myosin-1c’s role in E-cadherin tension and α-actinin recruitment at epithelial cell junctions.
Clinical importance of the EMSY gene expression and polymorphisms in ovarian cancer
Dansonka-Mieszkowska, Szafron, Moes-Sosnowska et al
Oncotarget (2018) 9 (25), 17735-17755 DOI: 10.18632/oncotarget.24878
Snippet: nitially, the EMSY gene silencing was performed with the use of the pGFP-B-RS vector (OriGene Technologies, Inc., Rockville, MD, USA) harboring one of three EMSY-specific shRNAs (Sh1, Sh2, Sh3) or a scrambled, non-silencing shRNA (SCR, a negative control), designed with the siRNA Wizard v3.1 web application (http://www.invivogen.com/sirnawizard/), see Supplementary Table 1 for details. In prelimin...
FigureFigureFigure
The metabolic function of cyclin D3-CDK6 kinase in cancer cell survival
Wang, Nicolay, Chick et al
Nature (2017) 546 (7658), 426-430 DOI: 10.1038/nature22797
AI Summary: OriGene's pGFP-B-RS plasmid (cat. TR30018) was used to generate shRNA constructs targeting RBL1 and CDK6, enabling the study of cyclin D3-CDK6's role in cancer cell metabolism and survival.
Snippet: … DNA oligomers 5′-GATCCCCGGCATCGA TAGTGATGCAGAATCCTCGAGGATTCTGCATCACTATCGATGTTTTTGA -3′ and 5′-AGCTTCAAAAACATCGATAGTGATGCAGAATCCTCGA GGATTCTGCATCACTATCGATGCCGGG-3′ were annealed and cloned into a pGFP-B-RS plasmid (cat. TR30018, Origene) at the BamHI and HindIII sites. …
Mitochondrial quality-control dysregulation in conditional HO-1(-/-) mice
Suliman, Keenan, Piantadosi
JCI Insight (2017) 2 (3), e89676 DOI: 10.1172/jci.insight.89676
AI Summary: OriGene products—pGFPCRS vector containing HO-1 oligonucleotide (TR30018), HO-1 TrueORF (MR203944), and NRF-1 TrueORF (MG208550)—were used for transfection experiments to modulate HO-1 and NRF-1 expression and investigate their roles in mitochondrial quality control in cardiomyocytes.
Snippet: Cells were transfected in 6-well plates at 70%–80% confluence with pGFPCRS vector containing HO-1 oligonucleotide sequence for optimal suppression of HO-1 (Origene, TR30018), HO-1 TrueORF (Origene, MR203944), or NRF-1 TrueORF (Origene, MG208550) using FuGENE-HD (Promega, E2311)
Showing 1-6 of 13 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products