Scrambled shRNA control in pRFP-CB-shLenti Vector

Snippet: … For TRPA1 KD in the NAc, 1 μl of either Trpa1-shRNA-lenti-RFP (1 × 107 TU/ml;Origene, Rockville, MD, USA) or scrambled-shRNA-lenti-RFP control virus (1 × 107 TU/ml;TR30033V, Origene) was injected bilaterally into the NAc (AP + 1.5 mm, ML ±1.0 mm and DV −4.5 mm from bregma;0° angle) of mice at a rate of 0.1 μl/min using a 33-gauge syringe needle

Snippet: … For TRPA1 KD in the NAc, 1 μl of either Trpa1-shRNA-lenti-RFP (1 × 107 TU/ml;Origene, Rockville, MD, USA) or scrambled-shRNA-lenti-RFP control virus (1 × 107 TU/ml;TR30033V, Origene) was injected bilaterally into the NAc (AP + 1.5 mm, ML ±1.0 mm and DV −4.5 mm from bregma;0° angle) of mice at a rate of 0.1 μl/min using a 33-gauge syringe needle

Snippet: In order to silence Cab45 expression, MDCK PLAP-sec cells were infected using lentiviral vector pRFP-CB-sh sequence TGTGAATACTGACCGGAAGATAAGCGCCA (Origene) or 12with non-effective 29-mer scrambled shRNA cassette in the same p-RFP-CB-sh Lenti Vector (ref. TR30033) as negative control

Snippet: activates HER2/3 and AKT signaling to promote cancer cell survival, and MSC-derived IL-6 promotes the progression of hepatocellular carcinoma via activation of STAT314,15. The effects MSCs have on tumorigenesis can also be dynamic, where for example, they impair progression during the initial stages of hepatocarcinoma but support later stages of the disease16. The opposing effects of MSCs on tumor

Snippet: pLenti PGK Hygro DEST (w530-1) Campeau et al., 2009 Addgene Plasmid #19066 pRFP-CB-shLenti Lentiviral vector OriGene Cat#TR30032

Snippet: H9c2 cells were stably transfected with 4-unique 29-mer shRNA constructs in lentiviral RFP- vector (Origene, SR02938179A, B, C and D) and non-effective 29-mer scrambled shRNA cassette in pRFP-CB-shLenti Vector as control (Origene, TR30033). Following 24- ... Cite SaveSaving