Scrambled shRNA control in pRFP-C-RS shRNA Vector

Snippet: taining and diI-AcLDL uptake), and all the cultures were routinely screened for mycoplasma and tested negative. In brief, rudhira shRNA vectors (715, 716) and scrambled (NS) control vector (TR30015) (Origene, USA) were microporated into SVEC (mouse EC line) and selected for stable line generation. Control cell line is referred to as ‘NS’ and rudhira knockdown as ‘KD’. For Rudhira overexpre

Snippet: Naltrindole (cat. no. N115), mouse RTP4 Mission short hairpin RNA (shRNA) Lentiviral Transduction Particles (cat. no. TRCN0000125615), AM281 (cat. no. A0980), and anti-FLAG M1 monoclonal antibody (cat. no. F3040) were from Millipore Sigma (St. Louis, MO). Control scrambled shRNA (cat. no. TR30015) was from Origene (Rockville, MD)

Snippet: A mixture of these three siRNAs was used for experiments. shRNA plasmids for bovine CHC (5′-CGGTTGCTCTTGTTACGGATAATGCAGTT-3′) and scrambled control (TR30015) tagged with RFP were purchased from Origene. The C1573S CHC mutant was generated from pEGFP-C1-CHC17(Addgene# 59799) plasmid. When Atto 532 (A532, Sigma), Atto 655 (A655, Sigma) or Alexa 488 (A488, Sigma) was included in the bath solut

Snippet: Cell line sources and generation is reported elsewhere [14]. In brief, rudhira shRNA vectors (715, 308 716), and scrambled (non- silencing) control vector (TR30015) (Origene, USA) were microporated 309 into SVEC (mouse endothelial cell line) and selected for stable line generation. …

Snippet: t. For rescue experiments involving PLCε KO chromaffin cells, cells 174 exhibiting overexpression of PLCε-FLAG were identified based on their mCherry fluorescence. 175 The scrambled shRNA and IP3R1 shRNA plasmids were purchased from OriGene;the 29mer 176 sequence of scrambled shRNA (Cat# TR30015) is 5’

Snippet: Sequence of Tgfb2-shRNA TGACCATCCTCTACTACATTGGCAATACG This paper N/A Sequence of scramble-shRNA GCACTACCAGAGCTAACTCAGATAGTACT OriGene Cat# TR30015 Forward primer for Bmp6 qPCR 5’- CCACCCAGTCGCAGGACGTG -3’ This paper N/A