OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Scrambled shRNA control in pRS shRNA Vector

Be the first to review this product
SKU
TR30012
29-mer Scrambled shRNA Cassette in pRS Vector, 5 ug
  $270.00
In Stock*
Specifications
Specifications
Product Data
shRNA Design These shRNA constructs were designed against multiple splice variants at this gene locus. To be certain that your variant of interest is targeted, please contact techsupport@origene.com. If you need a special design or shRNA sequence, please utilize our custom shRNA service.
Download Vector Sequence
Storage Store the vector DNA at -20°C.
Stability Vector DNA is stable for at least one year from date of receipt when stored at -20°C.
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

FBXO28 targets SNAI1 for ubiquitin-proteasomal degradation in non-small cell lung cancer
Lin, Qiao, Liu et al
J Biol Chem (2026)
AI Summary: OriGene products—including the pCMV6-FBXO28-Myc-Flag, pLenti-C-mGFP-P2A, pRS-shSNAI1, pRS-shSNAI2, and pRS-shRNA control plasmids—were used in this study to manipulate gene expression and investigate the role of FBXO28 in regulating SNAI1 stability and metastasis in non-small cell lung cancer.
Snippet: pCMV6-FBXO28-Myc-Flag (#RC206490), pLenti-C-mGFP-P2A (#PS100093), pRS-shSNAI1 (#TR309226A), pRS-shSNAI2 (#TR309225B) and pRS-shRNA control (#TR30012) plasmids were acquired from Origene
Pseudomonas aeruginosa 3-oxo-C12HSL-induced apoptosis involves bitter taste receptor T2R14 and the mitochondrial calcium uniporter
Miller, Mueller, Thompson et al
Cell Calcium (2026) 136, 103141 DOI: 10.1016/j.ceca.2026.103141
AI Summary: OriGene’s T2R14 shRNA (TR301238A-D), T2R39 shRNA (TR301234A-D), and scramble shRNA (TR30012) products were used to selectively knock down T2R14 and T2R39 expression, enabling the study to demonstrate the role of these receptors in Pseudomonas aeruginosa 3-oxo-C12HSL-induced apoptosis.
Snippet: For shRNA transfection, a cocktail of T2R14 shRNAs (OriGene #’s TR301238A, TR301238B, TR301238C, TR301238D), T2R39 shRNAs (OriGene #’s #TR301234A, #TR301234B, #TR301234C, #TR301234D), or scramble shRNAs (OriGene #TR30012) in pRS vector were transfected using Lipofectamine 3000 on days
Melanoma Leverages Innate Immune IRAK-M Signaling to Limit Metastasis Through PTPN22-Induced Signaling Repression
Geng, Chen, Sanchez et al
Cancer Lett (2025)
AI Summary: OriGene’s PTPN22 human shRNA plasmid kit (TR310061) and scrambled shRNA control (TR30012) were used in this study to knock down PTPN22 expression, enabling the authors to demonstrate the essential role of PTPN22 in mediating IRAK-M’s suppression of melanoma metastasis.
Snippet: … The PTPN22 PCR product was digested with BamHI and XhoI and ligated into the digested pCDH-EF1α-MCS-IRES-GFP, and then confirmed by DNA sequencing. We used PTPN22 human shRNA plasmid kit (TR310061), from OriGene, which includes constructs A to D in retroviral vector pRS along with a 29-mer scrambled shRNA cassette in the same Vector (TR30012) to knockdown PTPN22 expression. The shRNA sequences are TR310061 A: CGTTGTTACCAAGAGGATGACAGTGT
The polarity protein Par3 enhances renal cell carcinoma metastasis via YAP/TAZ activation
Lee, Balcazar, Davis et al
Cancer Biol Med (2025) 22 (7), 812-31 DOI: 10.20892/j.issn.2095-3941.2024.0297
Cited by 1
AI Summary: OriGene’s shRNA-Par3 (TR302678) and sc control plasmid (TR30012) were used to generate stable Par3 knockdown cell lines, enabling the study of Par3’s role in promoting renal cell carcinoma metastasis via YAP/TAZ pathway activation.
Snippet: To create clone cell lines with stable Par3 knockdown (KD), we mixed shRNA-Par3 (Origene, TR302678, retroviral vector) or sc control plasmid (Origene, TR30012) with;ereas overexpression (OE) of Par3 decreases pancreatic cancer metastasis12;both effects have been shown to be associated with Par3 regulation of the TIAM/RAC1 signaling pathway. …
FigureFigureFigure
TRPML1 agonist ML-SA5 mitigates uranium-induced nephrotoxicity via promoting lysosomal exocytosis
Zhang, Wang, Wang et al
Biomed Pharmacother (2024) 181, 117728 DOI: 10.1016/j.biopha.2024.117728
Cited by 5
AI Summary: OriGene products, specifically TRPML1 (MCOLN1) shRNA (#TR303307) and the corresponding empty vector (#TR30012), were used in this study to knock down TRPML1 expression in HK-2 cells, enabling the authors to investigate the role of TRPML1 in uranium-induced nephrotoxicity and the therapeutic effects of ML-SA5.
Snippet: or knockdown of TRPML1 and TFEB in HK-2 cells, the cells were seeded into 12-well plates (2 ×105 cells/well). After culturing for 18 hours, the cells were transfected with TRPML1 (MCOLN1) shRNA (OriGene, USA, #TR303307), TFEB shRNA (Miaolingbio, China, #P31675), or corresponding empty vectors (OriGene, #TR30012;Miaolingbio, #P0684), using Lipofectamine 3000 transfection reagent
FTO attenuates TNF-α-induced damage of proximal tubular epithelial cells in acute pancreatitis-induced acute kidney injury via targeting AQP3 in an N6-methyladenosine-dependent manner
Li, Liang, Liu et al
Ren Fail (2024) 46 (1), 2322037 DOI: 10.1080/0886022X.2024.2322037
AI Summary: OriGene products, specifically the shRNA targeting FTO (shFTO, TR308064) and scrambled shRNA control (shNC, TR30012), were used in this study to manipulate FTO expression and investigate its role in protecting kidney cells from damage in acute pancreatitis-induced acute kidney injury.
Snippet: o overexpress FTO and AQP3. An empty vector was used as the negative control. Short hairpin RNA (shRNA) targeting FTO (shFTO, TR308064) and scrambled shRNA control (shNC, TR30012) were purchased from Origene (Rockville, MD, USA). Thereafter, these constructs and the transfection kit (11668-027, Invitrogen, Carlsbad, CA, USA) were diluted in Opti-MEM serum-reduced medium (31985-062, Gibco, Grand Is
FigureFigureFigure
Showing 1-6 of 37 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products