Negative shRNA control in pRS Vector

Snippet: ainst B7-H3 (shB7-H3;sequence shRNA‐2, 5′-TCGTGTGCTGGAGAAAGATCAAACAGAGC‐3′) and control plasmid pRS nontarget TR30003 (shSCR;sequence 5′‐GCACTACCAGAGCTAACTCAGATAGTACT‐3′) (both from Origene Technologies). All cells were grown in RPMI-1640 (Sigma Aldrich) with addition of 10% fetal bovine serum and 2 mM L-glutamine. DUSP10 knockdown was performed by transfection of specific siRN

Snippet: Half of the cells were transfected with a control shRNA vector "Hush 300" (TR30003, Origene Technologies, Inc, Rockville, USA) and the other half with a 50:50 shRNA mix of "Hush 29" (TI308329, Origene, 5'-GCCTTCGTCGAGTTTAGTCACTTGCAGGA) and "Hush 30 ... All 5 versions Cite SaveSaving

Snippet: Plasmids and cell lines shRNA‐SirT7‐pRS (TI306753, TI306755), shRNA‐Scr‐pRS (TR30003, TR30012), pCMV6‐SirT7‐GFP (RG205658), and pCMV6‐H3.1 (RC214879) plasmids were obtained from Origene. SCR and SIRT7 siRNA were obtained from Sigma and Dharmacon, respectively. Human HA‐SirT7 and Flag‐SirT7 was cloned into pcDNA4/TO and pcDNA3.1 vectors (Invitrogen). Site‐directed mutagenesis was used to generate H3‐K18Q, H3‐K18R, and SirT7‐H188Y mutants. … H3K18 mutants, SIRT7‐Flag, and SIRT7‐H188Y‐Flag were subcloned into the pMSCVpuro vector and retroviral particles were generated as described previously (Serrano et al, 2013)

Snippet: 449) were described previously [9]. pRS vector (#TR20003), GFP-specific shRNA vector (#TR30003), and four human Prx6-targeted pRS shRNA expression vectors (#TR310191) were obtained from OriGene (OriGene Technologies, Inc., Rockville, MD). 2.2. ... Cite SaveSaving

Snippet: For some experiments, cells were transduced with the retroviral plasmid pRS-TI326599 containing a RIAM specific shRNA sequence or with pRS-TR30003, a plasmid containing a GFP shRNA as negative control (Hush shRNA Plasmid Panels 29-mer, OriGene Technologies) according to manufacturer’s instructions

Snippet: pRs-tR30003, containing a GFP-specific shRNa oligonucleotide as negative control (hush shRNa Plasmid Panels 29-mer, OriGene technologies, Rockville ... Where indi- cated, densitometric analysis was performed and the rela- tive band density quantification for each band was