OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Pfkfb3 Rat shRNA Plasmid (Locus ID 117276)

Be the first to review this product
SKU
TL712366
Pfkfb3 - Rat, 4 unique 29mer shRNA constructs in lentiviral GFP vector, 5µg of each construct provided
  $1,013.00
2 Weeks*

Frequently Bought Together (3)

EB200002 Lateral flow testing sticks used for the semi-quantitative detection of the lentiviral p24 protein, 20 tests
20 Tests
$450.00
TR30037 Lenti-vpak packaging kit - packaging plasmids and transfection reagent
10 reactions
$720.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Pfkfb3 or NM_057135"

Specifications
Specifications
Product Data
Locus ID 117276
Vector pGFP-C-shLenti
E. coli Selection Chloramphenicol (34 ug/ml)
Mammalian Cell Selection Puromycin
Format Lentiviral plasmids
Components Pfkfb3 - Rat, 4 unique 29mer shRNA constructs in lentiviral GFP vector(Gene ID = 117276). 5µg purified plasmid DNA per construct
29-mer scrambled shRNA cassette in pGFP-C-shLenti Vector, TR30021, included for free.
RefSeq NM_057135, NM_057135.1
UniProt ID O35552
Summary catalyzes the biosynthesis and degradation of fructose 2,6-bisphosphate, which plays a role in glycolysis RGD, Feb 2006
shRNA Design These shRNA constructs were designed against multiple splice variants at this gene locus. To be certain that your variant of interest is targeted, please contact techsupport@origene.com. If you need a special design or shRNA sequence, please utilize our custom shRNA service.
Storage Store at -20°C
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

Differential role of neuronal glucose and PFKFB3 in memory formation during development
Cruz, Bessières, Magistretti et al
Glia (2022)
Cited by 25
AI Summary: OriGene's Rat PFKFB3-shRNA plasmid (cat# TL712366) was used in this study to specifically knock down PFKFB3 expression, enabling the authors to investigate its role in neuronal glucose metabolism and memory formation during development.
Snippet: Rat PFKFB3-shRNA plasmid was purchased (Origene, cat# TL712366, GTAGTCAGACCTTCCTCTTACACCGAACTTCAAGAGAGTTCGGTGTAAGAGGAAGGTCTGACTACTTTTTT). Universal Scrambled-shRNA plasmid was purchased (VectorBiolabs, CCGGCAACAAGATGAAGAGCACCAACTCGA
Liposomes co-Loaded with 6-Phosphofructo-2-Kinase/Fructose-2, 6-Biphosphatase 3 (PFKFB3) shRNA Plasmid and Docetaxel for the Treatment of non-small Cell Lung Cancer
Chowdhury, Vhora, Patel et al
Pharm. Res. (2017)
AI Summary: OriGene contributed to this study by providing the Q-PCR primers for mouse PFKFB3 and the PFKFB3 shRNA plasmid (pshPFKFB3), which were essential for gene silencing and expression analysis experiments.
Snippet: Bio rad (California, USA). Q-PCR primers for mouse PFKFB3 were purchased from Origene (Rockville, MD). PFKFB3 plasmid (pshPFKFB) was obtained from Origene Technologies (Rockville, MD). Cell Lines The cell lines, A549
Showing 1-2 of 2 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products