OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Hdac2 Rat shRNA Plasmid (Locus ID 84577)

Be the first to review this product
SKU
TL711866
Hdac2 - Rat, 4 unique 29mer shRNA constructs in lentiviral GFP vector, 5µg of each construct provided
  $1,013.00
In Stock*

Frequently Bought Together (3)

EB200002 Lateral flow testing sticks used for the semi-quantitative detection of the lentiviral p24 protein, 20 tests
20 Tests
$450.00
TR30037 Lenti-vpak packaging kit - packaging plasmids and transfection reagent
10 reactions
$720.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Hdac2 or NM_053447"

Specifications
Specifications
Product Data
Locus ID 84577
Vector pGFP-C-shLenti
E. coli Selection Chloramphenicol (34 ug/ml)
Mammalian Cell Selection Puromycin
Format Lentiviral plasmids
Components Hdac2 - Rat, 4 unique 29mer shRNA constructs in lentiviral GFP vector(Gene ID = 84577). 5µg purified plasmid DNA per construct
29-mer scrambled shRNA cassette in pGFP-C-shLenti Vector, TR30021, included for free.
RefSeq NM_053447, NM_053447.1, BC161939
Summary may be involved in chromatin rearrangement during neural differentiation RGD, Feb 2006
shRNA Design These shRNA constructs were designed against multiple splice variants at this gene locus. To be certain that your variant of interest is targeted, please contact techsupport@origene.com. If you need a special design or shRNA sequence, please utilize our custom shRNA service.
Storage Store at -20°C
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

Ethanol exposure regulates Gabra1 expression via histone deacetylation at the promoter in cultured cortical neurons
Bohnsack, Patel, Morrow
J. Pharmacol. Exp. Ther. (2017)
AI Summary: OriGene contributed to this study by providing HDAC2 shRNA plasmids (Cat# TL7118660), which were used to knock down HDAC2 and assess its role in ethanol-induced regulation of Gabra1 expression in cultured cortical neurons.
Snippet: 5' CCCTACAATGACTACTTTGAA 3' 5' GCCAGTCATGTCCAAAGTAAT 3' 5' GCGTTCTATTCGCCCAGATAA 3' Lentivirus shRNA experiments for HDAC2 used shRNA plasmids from Origene (Cat# TL7118660). Target sequences for HDAC2 shRNAs were as follows: ... All 2 versions Cite SaveSaving
Nuclear Localization of the Transcriptional Regulator MIER1α Requires Interaction with HDAC1/2 in Breast Cancer Cells
Li, Paterno, Gillespie
PLoS ONE (2013) 8 (12), e84046 DOI: 10.1371/journal.pone.0084046
Cited by 15
AI Summary: OriGene products contributed to this study by providing plasmids containing ERα shRNA, HDAC1 shRNA, HDAC2 shRNA, and a control scrambled shRNA, which were used to investigate the roles of these proteins in the nuclear localization of MIER1α.
Snippet: Plasmids containing ERα shRNA, HDAC1 shRNA, HDAC2 shRNA or a control scrambled shRNA were purchased from Origene Technologies, Inc. Antibodies. The 9E10 anti-myc tag mouse monoclonal antibody was prepared as described in Blackmore et al. ... Cite SaveSaving
Epigenetic Control of GABAA-R Expression by Ethanol
Bohnsack
Thesis (2017)
Snippet: Lentivirus shRNA experiments for HDAC2 used shRNA plasmids from Origene (Cat# TL7118660). Target sequences for HDAC2 shRNAs were as follows: 5’ AGAAAGTGTGCTACTATTATGACGGTGAT 3’, 5’ GCTTGTGATGAAGAGTTCTCAGATTCTGA 3’, 5’ ACAACAGATCGCGTGATGACCGTCTCATT 3’, 5’ TCAAAGGTCACGCTAAATGTGTAGAAGTA 3’
Showing 1-3 of 3 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products