Pcna Rat shRNA Plasmid (Locus ID 25737)
SKU
TL710676
Pcna - Rat, 4 unique 29mer shRNA constructs in lentiviral GFP vector, 5µg of each construct provided
$1,013.00
2 Weeks*
Specifications
| Product Data | |
| Locus ID | 25737 |
|---|---|
| Synonyms | Pcna/cyclin; PCNAR |
| Vector | pGFP-C-shLenti |
| E. coli Selection | Chloramphenicol (34 ug/ml) |
| Mammalian Cell Selection | Puromycin |
| Format | Lentiviral plasmids |
| Components | Pcna - Rat, 4 unique 29mer shRNA constructs in lentiviral GFP vector(Gene ID = 25737). 5µg purified plasmid DNA per construct29-mer scrambled shRNA cassette in pGFP-C-shLenti Vector, TR30021, included for free. |
| RefSeq | NM_022381, NM_022381.1, NM_022381.2, NM_022381.3, BC060570 |
| UniProt ID | P04961 |
| Summary | cell cycle protein that may contribute to the repair of DNA damage and to cell proliferation caused by exposure to pulmonary toxicants; may influence cell survival in ischaemically compromised tissue RGD, Feb 2006 |
| shRNA Design | These shRNA constructs were designed against multiple splice variants at this gene locus. To be certain that your variant of interest is targeted, please contact techsupport@origene.com. If you need a special design or shRNA sequence, please utilize our custom shRNA service. |
| Storage | Store at -20°C |
| Shipping | Ambient |
Reviews
Documents
Resources
Citations
Gefitinib Synergizes with Irinotecan to Suppress Hepatocellular Carcinoma via Antagonizing Rad51-Mediated DNA-Repair
Shao, Xu, Peng et al
PLoS ONE (2016) 11 (1), e0146968 DOI: 10.1371/journal.pone.0146968
Shao, Xu, Peng et al
PLoS ONE (2016) 11 (1), e0146968 DOI: 10.1371/journal.pone.0146968
Cited by 24
AI Summary: In this study, the PCNA3.1 plasmid from OriGene was used to subclone target genes, facilitating experiments that investigated the molecular mechanisms by which gefitinib and irinotecan synergistically suppress hepatocellular carcinoma.
Snippet: CTTGGTACCGAGCTCGGATCCATGGCAATGCAGATGCAGCTTGAA;Reverse: TGCTGGATATCTGCAGAATTCTCAGTCTTTGGCATCTCCCACTC ) containing the EcoR I or BamH I restriction site and, subsequently, subcloned into the PCNA3.1 plasmid (Origene, Rockville ... Cite SaveSaving
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.
Related Products
- Price:
- Actual Price:
Welcome to OriGene AI!
I'm your AI-powered guide to everything OriGene.
Ask me anything:
- Product specs
- Ordering help
- Technical questions
- How to find exactly what your experiment needs
Prefer a live agent? Connect with us by clicking the green chat icon, as seen in the image below or email our team at custsupport@origene.com.
