OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Rora Rat shRNA Plasmid (Locus ID 300807)

Be the first to review this product
SKU
TL705407
Rora - Rat, 4 unique 29mer shRNA constructs in lentiviral GFP vector, 5µg of each construct provided
  $1,013.00
In Stock*

Frequently Bought Together (3)

EB200002 Lateral flow testing sticks used for the semi-quantitative detection of the lentiviral p24 protein, 20 tests
20 Tests
$450.00
TR30037 Lenti-vpak packaging kit - packaging plasmids and transfection reagent
10 reactions
$720.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Rora or NM_001106834"

Specifications
Specifications
Product Data
Locus ID 300807
Vector pGFP-C-shLenti
E. coli Selection Chloramphenicol (34 ug/ml)
Mammalian Cell Selection Puromycin
Format Lentiviral plasmids
Components Rora - Rat, 4 unique 29mer shRNA constructs in lentiviral GFP vector(Gene ID = 300807). 5µg purified plasmid DNA per construct
29-mer scrambled shRNA cassette in pGFP-C-shLenti Vector, TR30021, included for free.
RefSeq NM_001106834, NM_001106834.1
Summary The protein encoded by this gene is a member of the NR1 subfamily of nuclear hormone receptors. It can bind as a monomer or as a homodimer to hormone response elements upstream of several genes to enhance the expression of those genes. The encoded protein has been shown to interact with NM23-2, a nucleoside diphosphate kinase involved in organogenesis and differentiation, as well as with NM23-1, the product of a tumor metastasis suppressor candidate gene. Also, it has been shown to aid in the transcriptional regulation of some genes involved in circadian rhythm. provided by RefSeq, Feb 2014
shRNA Design These shRNA constructs were designed against multiple splice variants at this gene locus. To be certain that your variant of interest is targeted, please contact techsupport@origene.com. If you need a special design or shRNA sequence, please utilize our custom shRNA service.
Storage Store at -20°C
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

Sertoli cell specific knockdown of RAR-related orphan receptor (ROR) alpha at puberty reduces sperm count in rats
Mandal, Sarkar, Sharma et al
Gene (2017)
AI Summary: In this study, the hairpin and seed sequences for ROR-alpha specific shRNA, obtained from OriGene (USA), were used to design plasmid constructs for Sertoli cell-specific knockdown of ROR-alpha in rats, enabling investigation of its role in spermatogenesis.
Snippet: min each). 2.4. Plasmid constructs design. The hairpin (TCAAGAG) and seed (CAGTTGTGTGCTATCAAGATTACAGAAGC) sequence of ROR alpha specific shRNA were obtained from the web database of OriGene, USA. The ...;... min each). 2.4. Plasmid constructs design. The hairpin (TCAAGAG) and seed (CAGTTGTGTGCTATCAAGATTACAGAAGC) sequence of ROR alpha specific shRNA were obtained from the web database of OriGene, U...
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products