OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Zdhhc8 Rat shRNA Plasmid (Locus ID 303796)

Be the first to review this product
SKU
TL703608
Zdhhc8 - Rat, 4 unique 29mer shRNA constructs in lentiviral GFP vector, 5µg of each construct provided
  $1,013.00
In Stock*

Frequently Bought Together (3)

EB200002 Lateral flow testing sticks used for the semi-quantitative detection of the lentiviral p24 protein, 20 tests
20 Tests
$450.00
TR30037 Lenti-vpak packaging kit - packaging plasmids and transfection reagent
10 reactions
$720.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Zdhhc8 or NM_001039021"

Specifications
Specifications
Product Data
Locus ID 303796
Vector pGFP-C-shLenti
E. coli Selection Chloramphenicol (34 ug/ml)
Mammalian Cell Selection Puromycin
Format Lentiviral plasmids
Components Zdhhc8 - Rat, 4 unique 29mer shRNA constructs in lentiviral GFP vector(Gene ID = 303796). 5µg purified plasmid DNA per construct
29-mer scrambled shRNA cassette in pGFP-C-shLenti Vector, TR30021, included for free.
RefSeq NM_001039021, NM_001039021.1, NM_001039021.2
shRNA Design These shRNA constructs were designed against multiple splice variants at this gene locus. To be certain that your variant of interest is targeted, please contact techsupport@origene.com. If you need a special design or shRNA sequence, please utilize our custom shRNA service.
Storage Store at -20°C
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

Coupled Control of Distal Axon Integrity and Somal Responses to Axonal Damage by the Palmitoyl Acyltransferase ZDHHC17
Niu, Sanders, Jeong et al
Cell Rep (2020) 33 (7), 108365 DOI: 10.1016/j.celrep.2020.108365
Cited by 45
AI Summary: OriGene contributed to this study by providing a shRNA against rat Zdhhc17, which was used to investigate the role of ZDHHC17 in regulating axonal integrity and neuronal survival.
Snippet: … One shRNA against rat Zdhhc17 (sequence 5′-ATGAATGCCAGGAGATACAAGCACTTTAA-3′) was purchased from Origene and subcloned into lentiviral vector FEGW (Holland et al., 2016) together with its neighboring U6 promoter. A cassette containing a second shRNA against rat Zdhhc17 (sequence: 5′-CATTAAAGCTA;ATGAATGCCAGGAGATACAAGCACTTTAA-3′) was purchased from Origene and subcloned into lentiviral vector FEGW (Holland et al., 2016) together with its neighboring U6 promoter. A cassette containing a second shRNA against rat Zdhhc17 (sequence: 5′-CATTAAAGCTACAGAAGAA-3′ plus a neighboring H1 promoter was gene synthesized (Genewiz) and subcloned into FEGW. …
The palmitoyl acyltransferases ZDHHC5 and ZDHHC8 are uniquely present in DRG axons and control retrograde signaling via the Gp130/JAK/STAT3 pathway
Collura, Niu, Sanders et al
J. Biol. Chem. (2020) 295 (46), 15427-15437 DOI: 10.1074/jbc.RA120.013815
AI Summary: OriGene’s Zdhhc8 shRNA was used in this study to specifically knock down Zdhhc8 expression, enabling the authors to investigate its role in axonal retrograde signaling in DRG neurons.
Snippet: 5'- CCTCAGATGATTCCAAGAGAT-3';(7)) was used. To knock down Zdhhc8 expression, the shRNA (5'- CAGGATGCCACTCTCAGTGAGCCTAA AGC-3') (Origene) was used. Transfection and Lentiviral Production: HEK293T;- 5'- CCTCAGATGATTCCAAGAGAT-3'
Showing 1-2 of 2 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products