OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Adgrf5 Mouse shRNA Plasmid (Locus ID 224792)

Be the first to review this product
SKU
TL517926
Adgrf5 - Mouse, 4 unique 29mer shRNA constructs in lentiviral GFP vector, 5µg of each construct provided
  $1,013.00
2 Weeks*

Frequently Bought Together (3)

EB200002 Lateral flow testing sticks used for the semi-quantitative detection of the lentiviral p24 protein, 20 tests
20 Tests
$450.00
TR30037 Lenti-vpak packaging kit - packaging plasmids and transfection reagent
10 reactions
$720.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Adgrf5 or NM_001081178"

Specifications
Specifications
Product Data
Locus ID 224792
Synonyms 8430401C09Rik; 9330185D23; AI528491; Gpr116; mKIAA0758
Vector pGFP-C-shLenti
E. coli Selection Chloramphenicol (34 ug/ml)
Mammalian Cell Selection Puromycin
Format Lentiviral plasmids
Components Adgrf5 - Mouse, 4 unique 29mer shRNA constructs in lentiviral GFP vector(Gene ID = 224792). 5µg purified plasmid DNA per construct
29-mer scrambled shRNA cassette in pGFP-C-shLenti Vector, TR30021, included for free.
RefSeq NM_001081178, NM_001357332, NM_001081178.1, BC156418, BC172710
UniProt ID G5E8Q8
Summary Receptor that plays a critical role in lung surfactant homeostasis (PubMed:23590306, PubMed:23922714, PubMed:23684610). May play a role in controlling adipocyte function (PubMed:22971422).UniProtKB/Swiss-Prot Function
shRNA Design These shRNA constructs were designed against multiple splice variants at this gene locus. To be certain that your variant of interest is targeted, please contact techsupport@origene.com. If you need a special design or shRNA sequence, please utilize our custom shRNA service.
Storage Store at -20°C
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

Orphan GPR116 mediates the insulin sensitizing effects of the hepatokine FNDC4 in adipose tissue
Georgiadi, Lopez-Salazar, Merahbi et al
Nat Commun (2021) 12 (1), 2999 DOI: 10.1038/s41467-021-22579-1
Cited by 59
AI Summary: OriGene’s mouse FNDC4 cDNA clone (MR223815) was used as the template to PCR-amplify the extracellular domain of FNDC4 (sFNDC4), enabling the authors to study its role in insulin sensitization via GPR116 in adipose tissue.
Snippet: …The extracellular part of FNDC4 (sFNDC4) was PCR-amplified using mouse clone MR223815 (OriGene) as a template with the set of primers: forward—GAGAGCGGCCGCTCGACCTCCCTCTCCTGTG, reverse—GAGAGAATTCATTCCCCTGTCTGCAATGGC. The amplified sFNDC4 fragment was cloned into a SP-6xHis-Fc-pEFIRES;The extracellular part of FNDC4 (sFNDC4) was PCR-amplified using mouse clone MR223815 (OriGene) as a template with the set of primers
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products