OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Tet2 Mouse shRNA Plasmid (Locus ID 214133)

Be the first to review this product
SKU
TL513547
Tet2 - Mouse, 4 unique 29mer shRNA constructs in lentiviral GFP vector, 5µg of each construct provided
  $1,013.00
In Stock*

Frequently Bought Together (3)

EB200002 Lateral flow testing sticks used for the semi-quantitative detection of the lentiviral p24 protein, 20 tests
20 Tests
$450.00
TR30037 Lenti-vpak packaging kit - packaging plasmids and transfection reagent
10 reactions
$720.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Tet2 or NM_001040400"

Specifications
Specifications
Product Data
Locus ID 214133
Synonyms Ayu17-449; E130014J05Rik; mKIAA1546
Vector pGFP-C-shLenti
E. coli Selection Chloramphenicol (34 ug/ml)
Mammalian Cell Selection Puromycin
Format Lentiviral plasmids
Components Tet2 - Mouse, 4 unique 29mer shRNA constructs in lentiviral GFP vector(Gene ID = 214133). 5µg purified plasmid DNA per construct
29-mer scrambled shRNA cassette in pGFP-C-shLenti Vector, TR30021, included for free.
RefSeq NM_001040400, NM_001346736, NM_001040400.1, NM_001040400.2, BC031159, BC040785, NM_145989
UniProt ID Q4JK59
Summary Dioxygenase that catalyzes the conversion of the modified genomic base 5-methylcytosine (5mC) into 5-hydroxymethylcytosine (5hmC) and plays a key role in active DNA demethylation. Has a preference for 5-hydroxymethylcytosine in CpG motifs. Also mediates subsequent conversion of 5hmC into 5-formylcytosine (5fC), and conversion of 5fC to 5-carboxylcytosine (5caC). Conversion of 5mC into 5hmC, 5fC and 5caC probably constitutes the first step in cytosine demethylation. Methylation at the C5 position of cytosine bases is an epigenetic modification of the mammalian genome which plays an important role in transcriptional regulation. In addition to its role in DNA demethylation, also involved in the recruitment of the O-GlcNAc transferase OGT to CpG-rich transcription start sites of active genes, thereby promoting histone H2B GlcNAcylation by OGT.UniProtKB/Swiss-Prot Function
shRNA Design These shRNA constructs were designed against multiple splice variants at this gene locus. To be certain that your variant of interest is targeted, please contact techsupport@origene.com. If you need a special design or shRNA sequence, please utilize our custom shRNA service.
Storage Store at -20°C
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

Reprogramming of DNA methylation at NEUROD2-bound sequences during cortical neuron differentiation
Hahn, Jin, Li et al
Sci Adv (2019) 5 (10), eaax0080 DOI: 10.1126/sciadv.aax0080
AI Summary: OriGene contributed Tet2 shRNA knockdown vectors (catalog no. TL513547) to this study, enabling targeted gene silencing to investigate the role of TET2 in DNA methylation changes during cortical neuron differentiation.
Snippet: A set of knockdown vectors for Tet2 containing four unique 29-mer shRNA (GCCACAGAGACTCAACGGTTATCAGGCTT, GAACAGCATCAGAATGATTG-TGGCTCACC, CTGCGTTTCATCCAGTCTCTTGCTGAGAA, and GATACTCCT-GGTGAACAAAGTCAGAATGG) expression plasmids was obtained from OriGene (catalog no. TL513547), and the pool of shRNA
FigureFigureFigure
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products