OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Rapgef4 Mouse shRNA Plasmid (Locus ID 56508)

Be the first to review this product
SKU
TL509420
Rapgef4 - Mouse, 4 unique 29mer shRNA constructs in lentiviral GFP vector, 5µg of each construct provided
  $1,013.00
2 Weeks*

Frequently Bought Together (3)

EB200002 Lateral flow testing sticks used for the semi-quantitative detection of the lentiviral p24 protein, 20 tests
20 Tests
$450.00
TR30037 Lenti-vpak packaging kit - packaging plasmids and transfection reagent
10 reactions
$720.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Rapgef4 or NM_001204165"

Specifications
Specifications
Product Data
Locus ID 56508
Synonyms 1300003D15Rik; 5730402K07Rik; 6330581N18Rik; Epac-2; EPAC 2; Epac2; mKIAA4040
Vector pGFP-C-shLenti
E. coli Selection Chloramphenicol (34 ug/ml)
Mammalian Cell Selection Puromycin
Format Lentiviral plasmids
Components Rapgef4 - Mouse, 4 unique 29mer shRNA constructs in lentiviral GFP vector(Gene ID = 56508). 5µg purified plasmid DNA per construct
29-mer scrambled shRNA cassette in pGFP-C-shLenti Vector, TR30021, included for free.
RefSeq BC139822, NM_001204165, NM_001204166, NM_001204167, NM_019688, NM_001355478, NM_019688.1, NM_019688.2, NM_001204167.1, NM_001204166.1, NM_001204165.1
UniProt ID Q9EQZ6
Summary Guanine nucleotide exchange factor (GEF) for RAP1A, RAP1B and RAP2A small GTPases that is activated by binding cAMP. Seems not to activate RAB3A. Involved in cAMP-dependent, PKA-independent exocytosis through interaction with RIMS2.UniProtKB/Swiss-Prot Function
shRNA Design These shRNA constructs were designed against multiple splice variants at this gene locus. To be certain that your variant of interest is targeted, please contact techsupport@origene.com. If you need a special design or shRNA sequence, please utilize our custom shRNA service.
Storage Store at -20°C
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

Regulation of Glucose-Dependent Golgi-Derived Microtubules by cAMP/EPAC2 Promotes Secretory Vesicle Biogenesis in Pancreatic β Cells
Trogden, Zhu, Lee et al
Curr Biol (2019) 29 (14), 2339-2350.e5 DOI: 10.1016/j.cub.2019.06.032
Cited by 45
AI Summary: In this study, OriGene products, specifically the Epac2 (NM_006427) Human cDNA ORF Clone (RC221099) and EPAC2 shRNA (TL313162), were used to manipulate EPAC2 expression in pancreatic β cells, enabling the authors to investigate the role of cAMP/EPAC2 signaling in regulating Golgi-derived microtubules and insulin granule biogenesis.
Figure
Regulation of Glucose-Dependent Golgi-Derived Microtubules by cAMP/EPAC2 Promotes Secretory Vesicle Biogenesis in Pancreatic β Cells
Trogden, Zhu, Lee et al
Curr. Biol. (2019) 29 (14), 2339-2350.e5 DOI: 10.1016/j.cub.2019.06.032
AI Summary: OriGene products contributed to this study by providing EPAC2 Mouse shRNA (#1 TL509420A and #2 TL50942C), which were used to specifically knock down EPAC2 expression and investigate its role in regulating Golgi-derived microtubule formation and insulin secretion in pancreatic β cells.
Snippet: EPAC2 Mouse shRNA #1 Origene TL509420A CGACAAGGAAGACTTCAATCGGATTCTGA EPAC2 Mouse shRNA #2 Origene TL50942C CCATTACCACGCACAGCCTTCTCAAGGTA
Showing 1-2 of 2 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products