OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Dpp4 Mouse shRNA Plasmid (Locus ID 13482)

Be the first to review this product
SKU
TL500553
Dpp4 - Mouse, 4 unique 29mer shRNA constructs in lentiviral GFP vector, 5µg of each construct provided
  $1,013.00
In Stock*

Frequently Bought Together (3)

EB200002 Lateral flow testing sticks used for the semi-quantitative detection of the lentiviral p24 protein, 20 tests
20 Tests
$450.00
TR30037 Lenti-vpak packaging kit - packaging plasmids and transfection reagent
10 reactions
$720.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Dpp4 or NM_001159543"

Specifications
Specifications
Product Data
Locus ID 13482
Synonyms Cd26; Dpp-4; THAM
Vector pGFP-C-shLenti
E. coli Selection Chloramphenicol (34 ug/ml)
Mammalian Cell Selection Puromycin
Format Lentiviral plasmids
Components Dpp4 - Mouse, 4 unique 29mer shRNA constructs in lentiviral GFP vector(Gene ID = 13482). 5µg purified plasmid DNA per construct
29-mer scrambled shRNA cassette in pGFP-C-shLenti Vector, TR30021, included for free.
RefSeq BC022183, NM_001159543, NM_010074, NM_010074.1, NM_010074.2, NM_010074.3, NM_001159543.1
UniProt ID P28843
Summary Cell surface glycoprotein receptor involved in the costimulatory signal essential for T-cell receptor (TCR)-mediated T-cell activation. Acts as a positive regulator of T-cell coactivation, by binding at least ADA, CAV1, IGF2R, and PTPRC. Its binding to CAV1 and CARD11 induces T-cell proliferation and NF-kappa-B activation in a T-cell receptor/CD3-dependent manner. Its interaction with ADA also regulates lymphocyte-epithelial cell adhesion. In association with FAP is involved in the pericellular proteolysis of the extracellular matrix (ECM), the migration and invasion of endothelial cells into the ECM. May be involved in the promotion of lymphatic endothelial cells adhesion, migration and tube formation. When overexpressed, enhanced cell proliferation, a process inhibited by GPC3. Acts also as a serine exopeptidase with a dipeptidyl peptidase activity that regulates various physiological processes by cleaving peptides in the circulation, including many chemokines, mitogenic growth factors, neuropeptides and peptide hormones. Removes N-terminal dipeptides sequentially from polypeptides having unsubstituted N-termini provided that the penultimate residue is proline.UniProtKB/Swiss-Prot Function
shRNA Design These shRNA constructs were designed against multiple splice variants at this gene locus. To be certain that your variant of interest is targeted, please contact techsupport@origene.com. If you need a special design or shRNA sequence, please utilize our custom shRNA service.
Storage Store at -20°C
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

Dipeptidyl peptidase 4 contributes to Alzheimer's disease-like defects in a mouse model and is increased in sporadic Alzheimer's disease brains
Valverde, Dunys, Lorivel et al
J Biol Chem (2021) 297 (2), 100963 DOI: 10.1016/j.jbc.2021.100963
Cited by 24
AI Summary: OriGene's pGFP-C-shLenti vector (Cat. No. TR30023) and mouse CD26 (DPP4) shRNA (TL500553) were used in this study to genetically reduce DPP4 expression, enabling the authors to investigate its role in Alzheimer's disease-like defects in a mouse model.
Snippet: he CMV promoter. shRNA constructs TCATCACCGTGCCAATAGTTCTGCTGAGC (shDPP4) and GCACTACCAGAGCTA ACTCAGATAGTT (shScr) were inserted in the vector pGFP-C-sh Lenti under the U6 promoter (Cat. No. T R30023, OriGene). Gene-specific mouse shRNA sequences are TL500553 CD26 (Gene ID 13482) Mouse shRNA under the U6 promoter. Two- to three-month-old WT and 3xTg-AD mice were anesthetized by intraperitoneal inje
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products