OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

alpha Synuclein (SNCA) Human shRNA Plasmid Kit (Locus ID 6622)

Be the first to review this product
SKU
TL318860
SNCA - Human, 4 unique 29mer shRNA constructs in lentiviral GFP vector, 5µg of each construct provided
  $1,013.00
In Stock*

Frequently Bought Together (4)

TA506533 SNCA mouse monoclonal antibody, clone OTI2F6 (formerly 2F6) 100 ul
$447.00
EB200002 Lateral flow testing sticks used for the semi-quantitative detection of the lentiviral p24 protein, 20 tests
20 Tests
$450.00
TR30037 Lenti-vpak packaging kit - packaging plasmids and transfection reagent
10 reactions
$720.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "alpha Synuclein or NM_000345"

Specifications
Specifications
Product Data
Locus ID 6622
Synonyms NACP; PARK1; PARK4; PD1
Vector pGFP-C-shLenti
E. coli Selection Chloramphenicol (34 ug/ml)
Mammalian Cell Selection Puromycin
Format Lentiviral plasmids
Components SNCA - Human, 4 unique 29mer shRNA constructs in lentiviral GFP vector(Gene ID = 6622). 5µg purified plasmid DNA per construct
29-mer scrambled shRNA cassette in pGFP-C-shLenti Vector, TR30021, included for free.
RefSeq NM_000345, NM_001146054, NM_001146055, NM_007308, NM_000345.1, NM_000345.2, NM_000345.3, NM_007308.1, NM_007308.2, NM_001146054.1, NM_001146055.1, BC108275, BC013293, NM_001146054.2, NM_001146055.2, NM_000345.4
UniProt ID P37840
Summary Alpha-synuclein is a member of the synuclein family, which also includes beta- and gamma-synuclein. Synucleins are abundantly expressed in the brain and alpha- and beta-synuclein inhibit phospholipase D2 selectively. SNCA may serve to integrate presynaptic signaling and membrane trafficking. Defects in SNCA have been implicated in the pathogenesis of Parkinson disease. SNCA peptides are a major component of amyloid plaques in the brains of patients with Alzheimer's disease. Alternatively spliced transcripts encoding different isoforms have been identified for this gene. provided by RefSeq, Feb 2016
shRNA Design These shRNA constructs were designed against multiple splice variants at this gene locus. To be certain that your variant of interest is targeted, please contact techsupport@origene.com. If you need a special design or shRNA sequence, please utilize our custom shRNA service.
Storage Store at -20°C
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

Downregulation of Protease Cathepsin D and Upregulation of Pathologic α-Synuclein Mediate Paucity of DNAJC6-Induced Degeneration of Dopaminergic Neurons
Chiu, Chen, Weng et al
Int J Mol Sci (2024) 25 (12) DOI: 10.3390/ijms25126711
Cited by 9
AI Summary: OriGene contributed to this study by providing shRNA vectors targeting human α-synuclein (pRS shRNA), which were used to investigate the effects of α-synuclein knockdown on DNAJC6 deficiency-induced degeneration of dopaminergic neurons.
Snippet: a, Taipei, Taiwan. The pRS shRNA vector containing shRNA targeting human α-synuclein (shRNA1: 5′TCAGAAGTTGTTAGTGATTTGCTATCATA3′;shRNA2: 5′GGTATCAAGACTACGAACCTGAAGCCTAA3′) was purchased from OriGene (Rockville, MD, USA). Scrambled control (SC) shRNA and DNAJC6 or α-synuclein shRNA were transfected into dopaminergic neurons with Lipofectamine 2000 transfection reagent (ThermoFisher, Walth
FigureFigureFigure
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products