OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

XPD (ERCC2) Human shRNA Plasmid Kit (Locus ID 2068)

Be the first to review this product
SKU
TL313180
ERCC2 - Human, 4 unique 29mer shRNA constructs in lentiviral GFP vector, 5µg of each construct provided
  $1,013.00
2 Weeks*

Frequently Bought Together (4)

TA804192 ERCC2 mouse monoclonal antibody, clone OTI4B11 (formerly 4B11) 100 ul
$447.00
EB200002 Lateral flow testing sticks used for the semi-quantitative detection of the lentiviral p24 protein, 20 tests
20 Tests
$450.00
TR30037 Lenti-vpak packaging kit - packaging plasmids and transfection reagent
10 reactions
$720.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "XPD or NM_000400"

Specifications
Specifications
Product Data
Locus ID 2068
Synonyms COFS2; EM9; TFIIH; TTD; TTD1; XPD
Vector pGFP-C-shLenti
E. coli Selection Chloramphenicol (34 ug/ml)
Mammalian Cell Selection Puromycin
Format Lentiviral plasmids
Components ERCC2 - Human, 4 unique 29mer shRNA constructs in lentiviral GFP vector(Gene ID = 2068). 5µg purified plasmid DNA per construct
29-mer scrambled shRNA cassette in pGFP-C-shLenti Vector, TR30021, included for free.
RefSeq NM_000400, NM_001130867, NM_000400.1, NM_000400.2, NM_000400.3, NM_001130867.1, BC008346, BC108255, BC110522, BC110523, BM769772, BM988142, NM_000400.4
UniProt ID P18074
Summary The nucleotide excision repair pathway is a mechanism to repair damage to DNA. The protein encoded by this gene is involved in transcription-coupled nucleotide excision repair and is an integral member of the basal transcription factor BTF2/TFIIH complex. The gene product has ATP-dependent DNA helicase activity and belongs to the RAD3/XPD subfamily of helicases. Defects in this gene can result in three different disorders, the cancer-prone syndrome xeroderma pigmentosum complementation group D, trichothiodystrophy, and Cockayne syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. provided by RefSeq, Aug 2008
shRNA Design These shRNA constructs were designed against multiple splice variants at this gene locus. To be certain that your variant of interest is targeted, please contact techsupport@origene.com. If you need a special design or shRNA sequence, please utilize our custom shRNA service.
Storage Store at -20°C
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

XPD localizes in mitochondria and protects the mitochondrial genome from oxidative DNA damage
Liu, Fang, Chi et al
Nucleic Acids Res. (2015)
Cited by 65
AI Summary: OriGene’s XPD shRNA (shXPD) was used in this study to suppress XPD expression in human cells, enabling the authors to demonstrate XPD’s role in protecting mitochondrial DNA from oxidative damage.
Snippet: In brief, XPD shRNA (shXPD) sequence: GGCATCTACAACCTGGATGACC TGAAGGC (Origene) and shControl sequence GAAGAGGACAC GCCTTAGACT were cloned into pU2-FH lentiviral vector (kindly provided by Dr Yunfeng Feng). ... Cite SaveSaving
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products