OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

CRLF3 Human shRNA Plasmid Kit (Locus ID 51379)

Be the first to review this product
SKU
TL305215
CRLF3 - Human, 4 unique 29mer shRNA constructs in lentiviral GFP vector, 5µg of each construct provided
  $1,013.00
2 Weeks*

Frequently Bought Together (3)

EB200002 Lateral flow testing sticks used for the semi-quantitative detection of the lentiviral p24 protein, 20 tests
20 Tests
$450.00
TR30037 Lenti-vpak packaging kit - packaging plasmids and transfection reagent
10 reactions
$720.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "CRLF3 or NM_015986"

Specifications
Specifications
Product Data
Locus ID 51379
Synonyms CREME-9; CREME9; CRLM9; CYTOR4; FRWS; p48.2
Vector pGFP-C-shLenti
E. coli Selection Chloramphenicol (34 ug/ml)
Mammalian Cell Selection Puromycin
Format Lentiviral plasmids
Components CRLF3 - Human, 4 unique 29mer shRNA constructs in lentiviral GFP vector(Gene ID = 51379). 5µg purified plasmid DNA per construct
29-mer scrambled shRNA cassette in pGFP-C-shLenti Vector, TR30021, included for free.
RefSeq NM_015986, NR_073118, NM_015986.1, NM_015986.2, NM_015986.3, BC023567, NM_015986.4
UniProt ID Q8IUI8
Summary This gene encodes a cytokine receptor-like factor that may negatively regulate cell cycle progression at the G0/G1 phase. Studies of the related rat protein suggest that it may regulate neuronal morphology and synaptic vesicle biogenesis. This gene is one of several genes located in the neurofibromatosis type I tumor suppressor region on the q arm of chromosome 17, a region that is subject to microdeletions, duplications, chromosomal breaks and rearrangements. Alternative splicing of this gene results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 2 and 5. provided by RefSeq, Aug 2012
shRNA Design These shRNA constructs were designed against multiple splice variants at this gene locus. To be certain that your variant of interest is targeted, please contact techsupport@origene.com. If you need a special design or shRNA sequence, please utilize our custom shRNA service.
Storage Store at -20°C
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

Genetic Risk Factors for Neurodevelopmental Disorders: Insights from hiPSC-Cerebral Organoids
Wegscheid
Thesis (2022)
Snippet: Neurofibromatosis type 1 (NF1) is a common neurodevelopmental disorder (NDD) characterized by remarkable phenotypic variability, where affected children manifest a Save;shCRLF3 B: TACAGTCTGAGCAGTCGAAGAAATATAGC;shCRLF3 C: GACATTGAAGCCGTGACTCTAGGAACCAC;TL305215V, Origene) (MOI = 5) or control shRNA lentiviral particles (sc-108080, Santa Cruz Biotechnology;TR30021V shRNA scramble control particles, Origene) (MOI = 5). …
Patient-derived iPSC-cerebral organoid modeling of the 17q11.2 microdeletion syndrome establishes CRLF3 as a critical regulator of neurogenesis
Wegscheid, Anastasaki, Hartigan et al
Cell Rep (2021) 36 (1), 109315 DOI: 10.1016/j.celrep.2021.109315
Cited by 54
AI Summary: OriGene products, specifically TL305215V (shCRLF3 lentiviral particles) and TR30021V (shRNA scramble control particles), were used to manipulate CRLF3 expression in cell cultures to investigate its role in neurogenesis in patient-derived cerebral organoids.
Snippet: NA lentiviral particles (sc-94066-V, Santa Cruz Biotechnology;shCRLF3 A: AAAGGCTTCGCACATTCAGTTGGACAGCT;shCRLF3 B: TACAGTCTGAGCAGTCGAAGAAATATAGC;shCRLF3 C: GACATTGAAGCCGTGACTCTAGGAACCAC;TL305215V, Origene) (MOI = 5) or control shRNA lentiviral particles (sc-108080, Santa Cruz Biotechnology;TR30021V shRNA scramble control particles, Origene) (MOI = 5). Infected cultures were incubated with mTeS
FigureFigureFigure
Showing 1-2 of 2 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products