OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Ptgs2 Mouse shRNA Plasmid (Locus ID 19225)

Be the first to review this product
SKU
TG501784
Ptgs2 - Mouse, 4 unique 29mer shRNA constructs in retroviral GFP vector, 5µg of each construct provided
  $883.00
In Stock*

Frequently Bought Together (2)

TA385084 Cyclooxygenase 2 Rabbit monoclonal Antibody
100 ul
$380.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Ptgs2 or NM_011198"

Specifications
Specifications
Product Data
Locus ID 19225
Synonyms COX; Cox-; Cox-2; COX2; gripghs; PES-2; Pgh; PGHS; PGHS-2; Pghs2; PHS; PHS-2; PHS II; Tis; TIS10
Vector pGFP-V-RS
E. coli Selection Kanamycin
Mammalian Cell Selection Puromycin
Format Retroviral plasmids
Components Ptgs2 - Mouse, 4 unique 29mer shRNA constructs in retroviral GFP vector(Gene ID = 19225). 5µg purified plasmid DNA per construct
29-mer scrambled shRNA cassette in pGFP-V-RS Vector, TR30013, included for free.
RefSeq BC052900, NM_011198, NM_011198.1, NM_011198.2, NM_011198.3, NM_011198.4
UniProt ID Q05769
Summary This gene encodes an enzyme that is a member of the prostaglandin G/H synthase family. The encoded protein converts arachidonic acid to prostaglandin endoperoxide H2 which is a key enzymatic step in prostaglandin biosynthesis. This gene is the inducible prostaglandin G/H synthase family member that is upregulated during inflammation. Aberrant regulation of this gene is associated with cancer progression in several tissues and an increased risk of cardiovascular events. This gene is the target of many non-steroidal anti-inflammatory drugs. provided by RefSeq, Sep 2015
shRNA Design These shRNA constructs were designed against multiple splice variants at this gene locus. To be certain that your variant of interest is targeted, please contact techsupport@origene.com. If you need a special design or shRNA sequence, please utilize our custom shRNA service.
Storage Store at -20°C
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

Cell entry of bovine ephemeral fever virus requires activation of Src-JNK-AP1 and PI3K-Akt-NFκB pathways as well as Cox-2-mediated PGE2 /EP receptor signaling to enhance clathrin-mediated virus endocytosis
Cheng, Huang, Chi et al
Cell. Microbiol. (2015)
Cited by 40
AI Summary: OriGene products, including the Cox-2 shRNA construct (GI340290), EP2 shRNA construct (GI340313), EP4 shRNA construct (GI340311), scrambled negative shRNA (TR30013), and control vector pGFP-V-RS (TR30007), were used in this study to selectively knock down target genes and investigate their roles in BEFV-induced signaling pathways that facilitate virus entry.
Snippet: The Cox-2 shRNA construct GI340290 (TGCCTCAATTCAGTCTCTCATCTGCAATA, mouse 527 PTGS2 Gene ID 19225), the EP2 shRNA construct GI340313 (AACTTCCTGTTCTACACAGTCA 528 GATGCCA, human PTGER2 Gene ID 5732), the EP4 shRNA construct GI340311 529 (TGGTGCTTCATCGACTGGACCACCAACGT, human PTGER4 Gene ID 5734), scrambled Accepted Article29 530 negative shRNA (TR30013), and control vector pGFP-V-RS (TR30007) were from OriGene Co. 531 (Rockville, USA)
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products