OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Elavl4 Mouse shRNA Plasmid (Locus ID 15572)

Be the first to review this product
SKU
TG501025
Elavl4 - Mouse, 4 unique 29mer shRNA constructs in retroviral GFP vector, 5µg of each construct provided
  $883.00
In Stock*

Frequently Bought Together (1)

TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Elavl4 or NM_001038698"

Specifications
Specifications
Product Data
Locus ID 15572
Synonyms Elav; Hud; PNEM
Vector pGFP-V-RS
E. coli Selection Kanamycin
Mammalian Cell Selection Puromycin
Format Retroviral plasmids
Components Elavl4 - Mouse, 4 unique 29mer shRNA constructs in retroviral GFP vector(Gene ID = 15572). 5µg purified plasmid DNA per construct
29-mer scrambled shRNA cassette in pGFP-V-RS Vector, TR30013, included for free.
RefSeq BC048159, BC052451, NM_001038698, NM_001163397, NM_001163399, NM_001347178, NM_010488, NM_001357190, NM_001038698.1, NM_010488.1, NM_010488.2, NM_010488.4, NM_001163397.1, NM_001163399.1, BC051987
UniProt ID Q61701
Summary May play a role in neuron-specific RNA processing. Protects CDKN1A mRNA from decay by binding to its 3' UTR. Binds to AU-rich sequences (AREs) of target mRNAs, including VEGF and FOS mRNA (By similarity).UniProtKB/Swiss-Prot Function
shRNA Design These shRNA constructs were designed against multiple splice variants at this gene locus. To be certain that your variant of interest is targeted, please contact techsupport@origene.com. If you need a special design or shRNA sequence, please utilize our custom shRNA service.
Storage Store at -20°C
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

Translational derepression of Elavl4 isoforms at their alternative 5' UTRs determines neuronal development
Popovitchenko, Park, Page et al
Nat Commun (2020) 11 (1), 1674 DOI: 10.1038/s41467-020-15412-8
Cited by 57
AI Summary: OriGene products contributed to this study by providing Celf1 isoform-specific overexpression constructs (Celf1 Long, Cat# MC217278; Celf1 Short, Cat# MC216621), Celf1 mouse shRNA plasmid (Cat# TF514753B), and a custom Elavl4-v3 shRNA (Cat# HC121119A), which were used to manipulate gene expression and investigate the translational regulation of neuronal development.
Snippet: Elavl4 isoform specific overexpression plasmids were commercially obtained from Genecopoeia: Elavl4-v1 (Prod ID: EX-Mm30154-M46), Elavl4-v2 (Prod ID: EX-Mm26736-M46), Elavl4-v3 (Prod ID: EX-Mm29523-M46), and Elavl4-v4 (Prod ID: EX-Mm29524-M46). Celf1 isoform specific overexpression constructs were obtained from Origene: Celf1 Long (Variant 1;Cat# MC217278) and Celf1 Short (Variant 2;Cat# MC216621). Celf1 shRNAs were commercially obtained from Origene;Celf1 mouse shRNA Plasmid (Locus ID 13046) (Cat# TF514753B), and Genecopoeia;Celf1 Variant 1 Long (Prod ID;MSH031592-mU6) and Celf1 Variant 2 Short (Prod ID: MSH043146-mU6). Elavl4-v3 shRNA was custom made (Origene, Cat# HC121119A, TTTAAGAGAAGAGTCGAAGCGCTGCGAGA
FigureFigureFigure
Prenatal Deletion of the RNA-Binding Protein HuD Disrupts Postnatal Cortical Circuit Maturation and Behavior
Deboer, Azevedo, Vega et al
J. Neurosci. (2014) 34 (10), 3674-86 DOI: 10.1523/JNEUROSCI.3703-13.2014
AI Summary: OriGene’s HuD shRNA plasmid (sku TG501025) was used for in utero electroporation to knock down HuD expression in developing mouse brains, enabling the study of HuD’s role in neuronal specification and dendritic development.
Snippet: Electroporation and cell culture. In utero electroporations were performed using control shRNA and HuD shRNA plasmids (origene sku TG501025) coelectroporated with CAG-RFP or CAG-GFP, respectively, as described previously at E13.5 (Rasin et al., 2007). ... Cite SaveSaving
The role of HuD, a post-transcriptional regulator, in the development and function of the murine neocortex
DeBoer
Thesis (2014)
Snippet: In - utero electroporations were performed using control shRNA and HuD shRNA plasmids (origene sku TG501025) co - electroporated with CAG - RFP or CAG - GFP respectively as described at E13 .5 ( Rasin et al., 2007 ) . … HuD3 shRNA NM_001144775.1 Origene custom HLUC GeneCopoeia EX - hLU C - M46 Control ( Ctrl ) shRNA Origene TR30012 Control ( Ctrl ) shRNA Origene TR30015
Showing 1-3 of 3 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products