OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

ATM Human shRNA Plasmid Kit (Locus ID 472)

Be the first to review this product
SKU
TG320267
ATM - Human, 4 unique 29mer shRNA constructs in retroviral GFP vector, 5µg of each construct provided
  $883.00
In Stock*

Frequently Bought Together (2)

TA336258 Rabbit Polyclonal ATM Antibody
50 ul
$610.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "ATM or NM_000051"

Specifications
Specifications
Product Data
Locus ID 472
Synonyms AT1; ATA; ATC; ATD; ATDC; ATE; TEL1; TELO1
Vector pGFP-V-RS
E. coli Selection Kanamycin
Mammalian Cell Selection Puromycin
Format Retroviral plasmids
Components ATM - Human, 4 unique 29mer shRNA constructs in retroviral GFP vector(Gene ID = 472). 5µg purified plasmid DNA per construct
29-mer scrambled shRNA cassette in pGFP-V-RS Vector, TR30013, included for free.
RefSeq BC007023, NM_000051, NM_138292, NM_138293, NM_001351834, NM_001351835, NM_001351836, NM_138292.1, NM_138292.2, NM_138292.3, NM_000051.3, BC022306, BC022307, BC061584, BC137169, BC152385, BC152389, NM_000051.4
UniProt ID Q13315
Summary The protein encoded by this gene belongs to the PI3/PI4-kinase family. This protein is an important cell cycle checkpoint kinase that phosphorylates; thus, it functions as a regulator of a wide variety of downstream proteins, including tumor suppressor proteins p53 and BRCA1, checkpoint kinase CHK2, checkpoint proteins RAD17 and RAD9, and DNA repair protein NBS1. This protein and the closely related kinase ATR are thought to be master controllers of cell cycle checkpoint signaling pathways that are required for cell response to DNA damage and for genome stability. Mutations in this gene are associated with ataxia telangiectasia, an autosomal recessive disorder. provided by RefSeq, Aug 2010
shRNA Design These shRNA constructs were designed against multiple splice variants at this gene locus. To be certain that your variant of interest is targeted, please contact techsupport@origene.com. If you need a special design or shRNA sequence, please utilize our custom shRNA service.
Storage Store at -20°C
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

ATM regulation of IL-8 links oxidative stress to cancer cell migration and invasion
Chen, Ebelt, Stracker et al
Elife (2015) 4 DOI: 10.7554/eLife.07270
AI Summary: OriGene’s shATM and shNC (control) plasmids were used to generate stable ATM-depleted and control MDA-MB-231 cancer cell lines, enabling the study of ATM’s role in regulating IL-8 expression and cancer cell migration and invasion.
Snippet: Stable MDA-MB-231 shNC and shATM cells were made by using shATM (sequence: GAAGTAGAAGGAACCAGTTACCATGAATC) and shNC (control) plasmids from Origene. These cells were maintained in regular DMEM with 0.2 μg/ml puromycin
FigureFigureFigure
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products