OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

DNMT1 Human shRNA Plasmid Kit (Locus ID 1786)

Be the first to review this product
SKU
TG313404
DNMT1 - Human, 4 unique 29mer shRNA constructs in retroviral GFP vector, 5µg of each construct provided
  $883.00
In Stock*

Frequently Bought Together (2)

TA375561 DNMT1 Rabbit polyclonal Antibody
100 ul
$475.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "DNMT1 or NM_001130823"

Specifications
Specifications
Product Data
Locus ID 1786
Synonyms ADCADN; AIM; CXXC9; DNMT; HSN1E; m.HsaI; MCMT
Vector pGFP-V-RS
E. coli Selection Kanamycin
Mammalian Cell Selection Puromycin
Format Retroviral plasmids
Components DNMT1 - Human, 4 unique 29mer shRNA constructs in retroviral GFP vector(Gene ID = 1786). 5µg purified plasmid DNA per construct
29-mer scrambled shRNA cassette in pGFP-V-RS Vector, TR30013, included for free.
RefSeq NM_001130823, NM_001318730, NM_001318731, NM_001379, NM_001379.1, NM_001379.2, NM_001379.3, NM_001130823.1, NM_001130823.2, BC092517, BC126227, BC144093, NM_001130823.3
UniProt ID P26358
Summary This gene encodes an enzyme that transfers methyl groups to cytosine nucleotides of genomic DNA. This protein is the major enzyme responsible for maintaining methylation patterns following DNA replication and shows a preference for hemi-methylated DNA. Methylation of DNA is an important component of mammalian epigenetic gene regulation. Aberrant methylation patterns are found in human tumors and associated with developmental abnormalities. Variation in this gene has been associated with cerebellar ataxia, deafness, and narcolepsy, and neuropathy, hereditary sensory, type IE. Alternative splicing results in multiple transcript variants. provided by RefSeq, Jan 2016
shRNA Design These shRNA constructs were designed against multiple splice variants at this gene locus. To be certain that your variant of interest is targeted, please contact techsupport@origene.com. If you need a special design or shRNA sequence, please utilize our custom shRNA service.
Storage Store at -20°C
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

Cell entry of avian reovirus follows a caveolin-1-mediated and dynamin-2-dependent endocytic pathway that requires activation of p38 mitogen-activated protein kinase (MAPK) and Src signaling pathways as well as microtubules and small GTPase Rab5 protein
Huang, Wang, Chi et al
J. Biol. Chem. (2011) 286 (35), 30780-94 DOI: 10.1074/jbc.M111.257154
Cited by 15
AI Summary: OriGene’s dynamin-2 human shRNA (TG313406) and dynamin-2 siRNA construct (GI353617) were used in this study to effectively knock down dynamin-2 expression, helping to demonstrate its essential role in avian reovirus entry via a caveolin-1-mediated, dynamin-2-dependent endocytic pathway.
Snippet: V-RS vector and pGFP-V-RS vector) according to the manufacturer's instructions (dynamin-2 human shRNA, TG313406, OriGene Co.). ... and dynamin-2 siRNA construct GI353617 (CTACGGACCATCGGTGTCATCACCAAGCT) resulted in the most significant down-regulation
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products