OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Mir29a Mouse MicroRNA Expression Plasmid (MI0000576)

Be the first to review this product
SKU
SC400963
Expression plasmid for mouse microRNA Mir29a
  $424.00
In Stock*

Frequently Bought Together (1)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00

Other products for "Mir29a or MI0000576"

Specifications
Specifications
Product Data
Species Mouse
Vector pCMV-MIR
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequences
Precursor: ACCCCUUAGAGGAUGACUGAUUUCUUUUGGUGUUCAGAGUCAAUAGAAUUUUCUAGCACCAUCUGAAAUCGGUUAUAAUGAUUGGGGA:
Mature Sequence: ACUGAUUUCUUUUGGUGUUCAG:
Full Insert
>MI0000576 CTTGGTGGAGAACTACTTCGCTGCCGACCGCACAAAGAAATGAGTGTACAGCCCTGAAGTAAGTGTCCAG
TGTCTAAAACAGGCTACCAGAGCCTGCCCTCGCCCACCCTGCTTACCTCTGTGTTATGGATAGCTGATTA
GTCAACCACCGTTAGAATTGCATACTTGTTCATGTAATAAGCCTTCTCTGGAAGTGGACTCCACCATGCT
CGGATGAAGACCTACATATACGACAGATTGAAGGCCTGGGCCTTCCCAGTGCACATGACCTCTTGTGACC
CCTTAGAGGATGACTGATTTCTTTTGGTGTTCAGAGTCAATAGAATTTTCTAGCACCATCTGAAATCGGT
TATAATGATTGGGGAAGAGCACCGTTCAGCTGACTACGTTATTGCTGACGTTGGAGCCACAGGTAAGAAT
TAAGAAACAAATACCAAAACATGCTAAGGTACATTTTCTTCCTATCTTAAACTTGACTTTCATTAACACG
TGCCCCAGCAACAGCATGGTTAACTATTCACATAGTGATGGTGGGTGTGTTTTAGAAAGTGTGTATGGGT
TGCAGATTTGACGGTAACTAGAGGATAAAGGGCCAAACCAATGACTGACCAGTCAATGTGAGAGGAGCAG
GGGATATTTAC
Components 1 x 10 ug vial miRNA plasmid lyophilized in a 2-D bar-coded Matrix tube
Also Contains Both mature and minor (star) miRNA can be over expressed from the construct.
OTI Disclaimer All miRNA clones were sequenced to ensure that the pre-mir sequences match reference sequence in miRBase. The flanking sequence of a miRNA clone may differ from the NCBI reference with respect to biological polymorphisms. This should not affect the function of the mature miRNA.
Shipping Ambient
Reference Data
RefSeq MI0000576
Synonyms Mirn29a mmu-mir-29a
Locus ID 387222
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

microRNA-29a Regulates ADAM12 Through Direct Interaction With ADAM12 mRNA and Modulates Postischemic Perfusion Recovery
Lamin, Verry, Dokun et al
J Am Heart Assoc (2022) 11 (16), e025727 DOI: 10.1161/JAHA.122.025727
AI Summary: OriGene contributed to this study by providing the miR-29a expression plasmid (cat. number SC400963), which was used to overexpress miR-29a in vivo and investigate its effects on ADAM12 regulation and postischemic perfusion recovery.
Snippet: …number SC400963), and was commercially packaged into adeno‐associated virus 9 (AAV9) to produce AAV9‐miR‐29a viral particles by Vigene Biosciences (Rockville, MD). … number SC400963), and was commercially packaged into
Downregulation of the human peripheral myelin protein 22 gene by miR-29a in cellular models of Charcot-Marie-Tooth disease
Serfecz, Bazick, Al Salihi et al
Gene Ther. (2019) 26 (12), 455-464 DOI: 10.1038/s41434-019-0098-z
AI Summary: OriGene products contributed to this study by providing the empty pCMV vector (CAT#: PCMVMIR), the miR-29a expression plasmid (MI0000087), and the MegaTran transfection reagent (TT200003), which were used to transfect mouse Schwann cells and assess the effect of miR-29a on PMP22 gene expression.
Snippet: Transfection of mouse Schwann cell cultures. Primary mouse Schwann cells from WT and C22 mice were transfected with 1 µg of empty pCMV vector (CAT#: PCMVMIR) or with miR-29a (ORIGENE MI0000087) for 6 h using MegaTran (ORIGENE TT200003)
Altered miRNA-29 Expression in Type 2 Diabetes Influences Glucose and Lipid Metabolism in Skeletal Muscle
Massart, Sjögren, Lundell et al
Diabetes (2017)
AI Summary: OriGene's pri-miR-29a and pri-miR-29c plasmids were used to overexpress miR-29 in mouse skeletal muscle, enabling the study to demonstrate how increased miR-29 impairs glucose uptake and lipid metabolism relevant to type 2 diabetes.
Snippet: After one week of acclimatization, tibialis anterior muscle of 12 week old C57BL/6J mice was transfected with either a control plasmid or plasmid encoding for pri-miR-29a or pri-miR-29c (Origene, Rockville, MD) by electroporation as described (13). ... All 3 versions Cite SaveSaving
Showing 1-3 of 3 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products