OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Mir15a Mouse MicroRNA Expression Plasmid (MI0000564)

Be the first to review this product
SKU
SC400794
Expression plasmid for mouse microRNA Mir15a
  $424.00
In Stock*

Frequently Bought Together (1)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00

Other products for "Mir15a or MI0000564"

Specifications
Specifications
Product Data
Species Mouse
Vector pCMV-MIR
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequences
Precursor: CCCUUGGAGUAAAGUAGCAGCACAUAAUGGUUUGUGGAUGUUGAAAAGGUGCAGGCCAUACUGUGCUGCCUCAAAAUACAAGGA:
Mature Sequence: UAGCAGCACAUAAUGGUUUGUG:
Full Insert
>MI0000564 GTGTTAAGCACATTCAAAAGTTGTTAGTTTAATAAATGAGGTTCTTAAGTTGGTATGGGAAAATGACTTG
CTTTTCTCGTTTCATGACTACAATAAATTACAGCACTGTATTAAGTTTTCTGTACGCTTTTATTAAACTT
ATGATATGGAAATACTTTTTATTCTGCTGAAAGCCTATAAAATTATGCACATACCAGTGTTAGATTTTTT
TCAAACATAGATTTTATGTGTTCTACTTTTTCCTAAAAAGCCTTTTCTGTAAATTACTATTGAGGTGCTA
GGAGTTTTCAAAACCAACCCTTGGAGTAAAGTAGCAGCACATAATGGTTTGTGGATGTTGAAAAGGTGCA
GGCCATACTGTGCTGCCTCAAAATACAAGGACCTGATCTTCTGAAGAGAGTACCTGTCTTTTTATTCATA
GCTCCTATGATAGCAATGTCAGCGGTGCCTTAGCAGCACGTAAATATTGGCGTTAAGATTCTGAAATTAC
CTCCAGTATTGACTGTGCTGCTGAAGTAAGGTTGGCAATACTCTACAACTGTAATTCAATGTGTATTGAT
GTTACTTGTGTGTTTACACGGTTTTTCTAATTGCATTAGTGATTTTATGTTTGGTATGATTCTGTAATGA
TGTTAGTAACAACGCTCTACATATTGTGTCTGTT
Components 1 x 10 ug vial miRNA plasmid lyophilized in a 2-D bar-coded Matrix tube
Also Contains MI0000564, MI0000565
Both mature and minor (star) miRNA can be over expressed from the construct.
OTI Disclaimer All miRNA clones were sequenced to ensure that the pre-mir sequences match reference sequence in miRBase. The flanking sequence of a miRNA clone may differ from the NCBI reference with respect to biological polymorphisms. This should not affect the function of the mature miRNA.
Shipping Ambient
Reference Data
RefSeq MI0000564
Synonyms Mirn15a mmu-mir-15a
Locus ID 387174
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

T cell activation decreases microRNA-15a/16 levels to promote MEK1-ERK1/2-Elk1 signaling and promote proliferative capacity
Urena, Ma, Hoffmann et al
J Biol Chem (2022) 298 (3), 101634 DOI: 10.1016/j.jbc.2022.101634
Cited by 16
AI Summary: OriGene’s plasmid clone MI0000564 SC400794, containing the miR-15a and miR-16 sequences, was used to generate the DOX-inducible transgenic mouse model central to investigating the role of these microRNAs in T cell activation and proliferation.
Snippet: nstitute for Biogenesis Research Transgenic Mouse Core at the University of Hawaii at Manoa used transposon-enhanced pronuclear injection to generate a stable DOX-inducible miR-15a/16 mouse line. The Origene plasmid clone MI0000564 SC400794 containing a transgene including the mature miR-15a sequence (uagcagcacauaaugguuugug) and miR-16 sequence (uagcagcacguaaauauuggcg) with a 54 bp spacer sequence
Rbfox3 controls the biogenesis of a subset of microRNAs
Kim, Yang, Zhu et al
Nat. Struct. Mol. Biol. (2014)
Cited by 51
AI Summary: OriGene’s MicroRNA Expression Plasmids were used as DNA templates to generate pri-miRNA sequences (pri-miR-15a, pri-miR-485, pri-miR-214, and pri-miR-150) for in vitro analyses investigating Rbfox3’s role in microRNA biogenesis.
Snippet: DNA templates containing the T7 promoter and encoding an approximately 200-nt region of pri-miRNAs were generated by PCR from MicroRNA Expression Plasmids (OriGene) with the following primer sets: 5′-TTG TAA TAC GAC TCA CTA TAG GGA AGC CTT TTC TGT AAA TTA C-3′ and 5′-GCT ATC ATA GGA GCT ATG AAT AAA AAG-3′ for ​pri-miR-15a;5′-TTG TAA TAC GAC TCA CTA TAG GGA GAG AGT CGA TGT GTT CTT C-3′ and 5′-ACA T...
Showing 1-2 of 2 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products