OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Mir155 Mouse MicroRNA Expression Plasmid (MI0000177)

Be the first to review this product
SKU
SC400793
Expression plasmid for mouse microRNA Mir155
  $424.00
In Stock*

Frequently Bought Together (1)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00

Other products for "Mir155 or MI0000177"

Specifications
Specifications
Product Data
Species Mouse
Vector pCMV-MIR
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequences
Precursor: CUGUUAAUGCUAAUUGUGAUAGGGGUUUUGGCCUCUGACUGACUCCUACCUGUUAGCAUUAACAG:
Mature Sequence: UUAAUGCUAAUUGUGAUAGGGGU:
Full Insert
>MI0000177 AATATTTCCACAGAATTTAAAGTTTGATTTTATAATTAGTTTTTAAATTGCAAACCTTACAAAAATTTTC
CAAAATTTACTTAGAAGCATTTCAGAGCTCTTTTCTTTCAAAGCTGAAGTCTACCTTGCCTTCAGATTCA
TAATCGTTCACTCTACTTTATAACTAACTGTGTGCGTACACACAACTATTTCTTTTTCTCTTTGCAGGTG
CTGCAAACCAGGAAGGGGAAGTGTGTGGTTTAAGTTGCATATCCCTTATCCTCTGGCTGCTGGAGGCTTG
CTGAAGGCTGTATGCTGTTAATGCTAATTGTGATAGGGGTTTTGGCCTCTGACTGACTCCTACCTGTTAG
CATTAACAGGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCCACCGTGGGAGGATGACAAG
TCCAAGAGTCACCCTGCTGGATGAACGTAGATGTCAGACTCTATCATTTAATGTGCTAGTCATAACCTGG
TTACTAGGATAGTCCACTGTAAGTGTTACGATAAATGTCATTTAAAAGATAGATCAGCAGTATCCTAAAC
AACATCTCAACTTCAAGCCCACATGTTTATTTTTTATCTTGAATGGAAAGTGAAACTTGTATCATTTTTA
TTTCAAAATTATGTTCATAACCATCTT
Components 1 x 10 ug vial miRNA plasmid lyophilized in a 2-D bar-coded Matrix tube
Also Contains Both mature and minor (star) miRNA can be over expressed from the construct.
OTI Disclaimer All miRNA clones were sequenced to ensure that the pre-mir sequences match reference sequence in miRBase. The flanking sequence of a miRNA clone may differ from the NCBI reference with respect to biological polymorphisms. This should not affect the function of the mature miRNA.
Shipping Ambient
Reference Data
RefSeq MI0000177
Synonyms Mirn155 mmu-mir-155
Locus ID 387173
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

miR-155-5p can be involved in acquisition of osseointegration on titanium surface
Yamamura, Miyoshi, Mouri et al
In Vitro Cell Dev Biol Anim (2022)
Cited by 3
AI Summary: OriGene products, specifically the miR-155-5p expression plasmid (sc400793) and MegaTran 1.0 Transfection Reagent, were used to overexpress miR-155-5p in MC3T3-E1 cells, enabling the authors to investigate its role in osteogenic differentiation and osseointegration on titanium surfaces.
Snippet: The expression plasmid for miR-155-5p (sc400793, OriGene Technologies, Rockville, MD) was transfected into MC3T3-E1 cells by using MegaTran 1.0 Transfection Reagent (OriGene Technologies). In brief, cells were seeded on a 24-well plate at 5 × 105/well, and 1 µg of miR-155-5p expression plasmid, 100 µl of Opti-MEM (Thermo Fisher Scientific), and 3 µl of MegaTran were
miRNA-93 inhibits GLUT4 and is overexpressed in adipose tissue of polycystic ovary syndrome patients and women with insulin resistance
Chen, Heneidi, Lee et al
Diabetes (2013) 62 (7), 2278-86 DOI: 10.2337/db12-0963
Cited by 288
AI Summary: OriGene products, including primers for mature miRNAs, mouse Actb, and Glut4, as well as miR-93 overexpression (#SC400793) and empty (Cat# PCMVMIR) vectors, were used in this study to measure gene expression and manipulate miR-93 levels in adipocytes, enabling the investigation of miR-93’s role in regulating GLUT4 and insulin resistance in PCOS.
Snippet: Primers for mature miRNAs and mouse Actb and Glut4 were purchased from OriGene (Rockville, MD). miR-103 was used as an internal control (35). ... overexpression (#SC400793) and empty (Cat# PCMVMIR) vectors were purchased from OriGene (Rockville, MD).
Showing 1-2 of 2 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products