OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

MIR29c Human MicroRNA Expression Plasmid (MI0000735)

Be the first to review this product
SKU
SC400312
Expression plasmid for human microRNA MIR29c
  $424.00
In Stock*

Frequently Bought Together (1)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00

Other products for "MIR29c or MI0000735"

Specifications
Specifications
Product Data
Species Human
Vector pCMV-MIR
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequences
Precursor: AUCUCUUACACAGGCUGACCGAUUUCUCCUGGUGUUCAGAGUCUGUUUUUGUCUAGCACCAUUUGAAAUCGGUUAUGAUGUAGGGGGA:
Mature Sequence: UGACCGAUUUCUCCUGGUGUUC:
Full Insert
>MI0000735 TCTGTTGACTCCTAGCAGCCATCACCAGCATGAATGTGTTCGTAGGGCCTTTGAGTGTGGCGATTGTCAT
ATTCTGTTGGATAACAATGTATTGGGTGTCGATTGTCATGGGGCAGGGGAGAGGGCAGTACACCTGGAGG
ACCATTTTGTCCACATCGACACCATCAGTCTGCTCTTAGAGGATGCCCTGGAGTATTCGGCGTTGATTGC
GGGGCACCCGAAATCAGACTTGCCACCTGGACTGTCGAGGTGCAGACCCTGGGAGCACCACTGGCCCATC
TCTTACACAGGCTGACCGATTTCTCCTGGTGTTCAGAGTCTGTTTTTGTCTAGCACCATTTGAAATCGGT
TATGATGTAGGGGGAAAAGCAGCAGCCTCGAAGCCTCATGCCAACTCTGGGCAGCAGCAGCCTGTGGTTT
CCTGGAAGATGGATGGGCAGAGAATAGGGAAGGAAGATCATGCTTTTCCCTACTAACTTCTGTAACTGCA
TGTATGATACATTATTGCAGAGGTAAGAGATAGTTTAATGGATTTTTAAAAACAAATTACTATAATTTAT
CTGATGTTCTCTAGTTGCATTTTGCTGAAATGTAGTGCTGTTCTAAATTCTGTAAATTGATTGCTGTTGA
ATTATCTTTCTGTTGAGAAGAGTCTATTCATGC
Components 1 x 10 ug vial miRNA plasmid lyophilized in a 2-D bar-coded Matrix tube
Also Contains Both mature and minor (star) miRNA can be over expressed from the construct.
OTI Disclaimer All miRNA clones were sequenced to ensure that the pre-mir sequences match reference sequence in miRBase. The flanking sequence of a miRNA clone may differ from the NCBI reference with respect to biological polymorphisms. This should not affect the function of the mature miRNA.
Shipping Ambient
Reference Data
RefSeq MI0000735
Synonyms MIRN29C miRNA29C
Locus ID 407026
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

miR-29c Increases Protein Synthesis in Skeletal Muscle Independently of AKT/mTOR
Alves, Cruz, Silva et al
Int J Mol Sci (2022) 23 (13) DOI: 10.3390/ijms23137198
Cited by 8
AI Summary: OriGene products, specifically the pCMVmiR-29c plasmid, were used to overexpress miR-29c in skeletal muscle, enabling the study of its effects on muscle fiber size, force, and protein synthesis in the referenced paper.
FigureFigureFigure
miR-29c plays a suppressive role in breast cancer by targeting the TIMP3/STAT1/FOXO1 pathway
Li, Yi, Zheng et al
Clin Epigenetics (2018) 10, 64 DOI: 10.1186/s13148-018-0495-y
AI Summary: OriGene’s miR-29c mimic and anti-miR-29c were used to manipulate miR-29c levels in breast cancer cells, enabling the researchers to study the effects of miR-29c on cancer cell proliferation, migration, invasion, and related molecular pathways.
Snippet: Cells which were transfected with anti-miR-29c and miR-29c mimic (Origene, Rockville, MD) were seeded in 96-well plates at 2 × 10 3 /well, respectively, and cultured for 24, 48, 72, and 96 h. Ten microliters CCK-8 (Dojindo, Kumamoto, Japan) was added to the cells Cached
FigureFigureFigure
Altered miRNA-29 Expression in Type 2 Diabetes Influences Glucose and Lipid Metabolism in Skeletal Muscle
Massart, Sjögren, Lundell et al
Diabetes (2017)
AI Summary: OriGene's pri-miR-29a and pri-miR-29c plasmids were used to overexpress miR-29 in mouse skeletal muscle, enabling the study to demonstrate how increased miR-29 impairs glucose uptake and lipid metabolism relevant to type 2 diabetes.
Snippet: After one week of acclimatization, tibialis anterior muscle of 12 week old C57BL/6J mice was transfected with either a control plasmid or plasmid encoding for pri-miR-29a or pri-miR-29c (Origene, Rockville, MD) by electroporation as described (13). ... All 3 versions Cite SaveSaving
Showing 1-3 of 3 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products