OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

MIR27a Human MicroRNA Expression Plasmid (MI0000085)

Be the first to review this product
SKU
SC400302
Expression plasmid for human microRNA MIR27a
  $424.00
In Stock*

Frequently Bought Together (1)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00

Other products for "MIR27a or MI0000085"

Specifications
Specifications
Product Data
Species Human
Vector pCMV-MIR
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequences
Precursor: CUGAGGAGCAGGGCUUAGCUGCUUGUGAGCAGGGUCCACACCAAGUCGUGUUCACAGUGGCUAAGUUCCGCCCCCCAG:
Mature Sequence: AGGGCUUAGCUGCUUGUGAGCA:
Full Insert
>MI0000085 CCCTGTGATCAAAGGAAGCATCTGGGGACCTGGAGGGGAGGTGTCCCCAAATCTCATTACCTCCTTTGCT
CTCTCTCTCTTTCTCCCCTCCAGGTGCCAGCCTCTGGCCCCGCCCGGTGCCCCCCTCACCCCTGTGCCAC
GGCCGGCTGGGGTTCCTGGGGATGGGATTTGCTTCCTGTCACAAATCACATTGCCAGGGATTTCCAACCG
ACCCTGAGCTCTGCCACCGAGGATGCTGCCCGGGGACGGGGTGGCAGAGAGGCCCCGAAGCCTGTGCCTG
GCCTGAGGAGCAGGGCTTAGCTGCTTGTGAGCAGGGTCCACACCAAGTCGTGTTCACAGTGGCTAAGTTC
CGCCCCCCAGGCCCTCACCTCCTCTGGCCTTGCCGCCTGTCCCCTGCTGCCGCCTGTCTGCCTGCCATCC
TGCTGCCTGGCCTCCCTGGGCTCTGCCTCCCGTGCCTACTGAGCTGAAACACAGTTGGTTTGTGTACACT
GGCTCAGTTCAGCAGGAACAGGGGTCAAGCCCCCTTGGAGCCTGCAGCCCCTGCCTTCCCTGGGTGGGCT
GATGCTTGGAGCAGAGATGAGGACTCAGAATCAGACCTGTGTCTGGAGGAGGGATGTGGTGGGTGGGGTT
GGCTGGGCCCAAATGTGTGCTGCAG
Components 1 x 10 ug vial miRNA plasmid lyophilized in a 2-D bar-coded Matrix tube
Also Contains Both mature and minor (star) miRNA can be over expressed from the construct.
OTI Disclaimer All miRNA clones were sequenced to ensure that the pre-mir sequences match reference sequence in miRBase. The flanking sequence of a miRNA clone may differ from the NCBI reference with respect to biological polymorphisms. This should not affect the function of the mature miRNA.
Shipping Ambient
Reference Data
RefSeq MI0000085
Synonyms MIR27 MIRN27A
Locus ID 407018
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

The 3'UTR of human MAVS mRNA contains multiple regulatory elements for the control of protein expression and subcellular localization
Xu, Peng, Gu et al
Biochim Biophys Acta Gene Regul Mech (2018) 1862 (1), 47-57 DOI: 10.1016/j.bbagrm.2018.10.017
AI Summary: OriGene’s pCMV-MIR vector was used to construct the miR-27a overexpression plasmid, enabling the study of miR-27a’s regulatory effects on MAVS expression and antiviral function in this research.
Snippet: respective primer pairs (Table S1). The miR-27a overexpression vector was cloned into pCMV-MIR (OriGene, USA) with Sgf I and Mlu I for overexpressing miR-27a precursors (Table S1). The overexpression vector for HuR
MIR-27a regulates the TGF-β signaling pathway by targeting SMAD2 and SMAD4 in lung cancer
Chae, Ban, Yoo et al
Mol. Carcinog. (2017)
AI Summary: OriGene products pCMV-miR-27a and pCMV-miR Negative Control were used to manipulate miR-27a expression in lung cancer cells, enabling the study of its regulatory effects on SMAD2 and SMAD4 in the TGF-β signaling pathway.
Snippet: and 1% penicillin-streptomycin (Hyclone, USA) in a humidified chamber with 5% CO2 at 37°C. The pCMV-miR-27a (miR-27a) and pCMV-miR Negative Control (miR-NC) were purchased from OriGene (Rockville, MD, USA). The pCMV-miR-27a provides constitutive ... All 2 versions Cite SaveSaving
Dysregulation of miRNAs-COUP-TFII-FOXM1-CENPF axis contributes to the metastasis of prostate cancer
Lin, Kao, Lee et al
Nat Commun (2016) 7, 11418 DOI: 10.1038/ncomms11418
Cited by 125
AI Summary: OriGene Technologies' miRNA expression vectors were used to generate inducible constructs for miR-101, miR-27a, and COUP-TFII, enabling the study of their roles in prostate cancer metastasis and drug resistance.
Snippet: To set up inducible miR-101, miR-27a and COUP-TFII constructs, miRNA expression vectors were purchased (Origene Technologies, Inc) and construction of a COUP-TFII expression vector was described previously13
Showing 1-3 of 3 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products