OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

MIR193a Human MicroRNA Expression Plasmid (MI0000487)

Be the first to review this product
SKU
SC400232
Expression plasmid for human microRNA MIR193a
  $424.00
In Stock*

Frequently Bought Together (1)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00

Other products for "MIR193a or MI0000487"

Specifications
Specifications
Product Data
Species Human
Vector pCMV-MIR
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequences
Precursor: CGAGGAUGGGAGCUGAGGGCUGGGUCUUUGCGGGCGAGAUGAGGGUGUCGGAUCAACUGGCCUACAAAGUCCCAGUUCUCGGCCCCCG:
Mature Sequence: UGGGUCUUUGCGGGCGAGAUGA:
Full Insert
>MI0000487 CTGCGGTGGGGAGGCTTTGGTCCCCGCACCTCCCCCTCCCCCAGCGCTGTCCCTCGGCCTGAGCCGAGGC
GGCCCGGGGGTGGCGTGGAGGCCGCCGAGCGTCGTGTAACCCTTGGAGGGCTGGGTTTGGAGCCCGCGAC
CCGAGGTCGGGCGGGGCGGTGGACTTTCCCGGGGAACGCCGCCTGAGGGACACCCAGAGCTTCGGCGGAG
CGGAGCGCGGTGCACAGAGCCGGCGACCGGACCCAGCCCCGGGAAGCCCGTCGGGGACGCACCCCGAACT
CCGAGGATGGGAGCTGAGGGCTGGGTCTTTGCGGGCGAGATGAGGGTGTCGGATCAACTGGCCTACAAAG
TCCCAGTTCTCGGCCCCCGGGACCAGCGTCTTCTCCCCGGTCCTCGCCCCAGGCCGGCTTCCTCCCGGGC
TGGCGTGCGCTCCGGCCAGGCTGCCTCTCAGGTCCACGCTGGAGAAGGAGTGGTGAGGTGCGCTCGCCCC
GGCTGCGTGCGGTGATTCGGGAAATCCCCGCACTTCGCTGGAGAAATAGCGACGCTCTCGGAAGTGTGAG
TCGGTCACTGCTTGGGGTCCGTACCCTTTGGGCAGACGTGGACCGCGCCCCGGCGACCTGGGTTGAGTGG
ACAGACGGGACC
Components 1 x 10 ug vial miRNA plasmid lyophilized in a 2-D bar-coded Matrix tube
Also Contains Both mature and minor (star) miRNA can be over expressed from the construct.
OTI Disclaimer All miRNA clones were sequenced to ensure that the pre-mir sequences match reference sequence in miRBase. The flanking sequence of a miRNA clone may differ from the NCBI reference with respect to biological polymorphisms. This should not affect the function of the mature miRNA.
Shipping Ambient
Reference Data
RefSeq MI0000487
Synonyms MIRN193 MIRN193A
Locus ID 406968
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

MiR193a Modulation and Podocyte Phenotype
Jha, Saha, Ayasolla et al
Cells (2020) 9 (4) DOI: 10.3390/cells9041004
Cited by 9
AI Summary: In this study, OriGene's miR193a expression plasmid (cat. no. SC400232) and empty vector (pCMV-MIR) were used to modulate miR193a levels in podocyte cells, enabling the investigation of miR193a's role in regulating APOL1 expression and podocyte molecular markers.
Snippet: …The mammalian microRNAs (miR) are mainly transcribed by Polymerase II (Pol II), resulting in the formation of capped, m;A specific miR193a inhibitor (25 nM;cat. no. 4464084;Thermo Fisher Scientific, Waltham, MA, USA), miR193a expression plasmid (25 nM;cat. … SC400232;OriGene, Rockville, MD, USA), and empty vector (25 nM;pCMV-MIR;OriGene, Rockville, MD, USA) were transfected in the control and experimental cells (UPDs or DPDs) using Lipofectamine 3000 Transfection Reagent (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s protocol. …
Disrupted APOL1-miR193a Axis Dedifferentiates Podocytes through Autophagy Blockade in APOL1 Risk Milieu
Kumar, Ayasolla, Jha et al
Am. J. Physiol., Cell Physiol. (2019)
AI Summary: OriGene’s miR193a expression plasmid (Cat #SC400232) and pCMV-MIR empty vector were used to manipulate miR193a levels in podocytes, enabling the study of how the APOL1-miR193a axis affects podocyte differentiation and autophagy.
Snippet: 198 Transfection of miR193a expression plasmid 199 miR193a expression plasmid (25 nM;Cat #SC400232;Origene), and empty vector (25 200 nM;pCMV-MIR;Origene) were transfected in cells using Lipofectamine 3000 201
Modulation of APOL1-miR193a Axis Prevents Podocyte Dediffrentiation in High Glucose Milieu
Mishra, Ayasolla, Kumar et al
Am. J. Physiol. Renal Physiol. (2018)
AI Summary: OriGene products, specifically the miR193a expression plasmid (Cat #SC400232) and the empty vector pCMV-MIR, were used for transfecting podocytes to study the role of miR193a in dedifferentiation under high glucose conditions in this research.
Snippet: miR193a inhibitor (25 nM;Cat #4464084;Thermofisher, USA), miR193a expression 129 plasmid (25 nM;Cat #SC400232;Origene), and empty vector (25 nM;pCMV-MIR;130 Origene) were transfected in the cells using Lipofectamine 3000 Transfection Reagent 131
miR-193a-5p Inhibits Migration and Invasion of Colorectal Cancer Cells Via Targeting Vimentin
Noorolyai, Baradaran
Advances in Bioscience and Clinical Medicine (2019)
Snippet: via Targeting Vimentin 3 snRNA) and miR-193a-5p was purchased from ORIGENE Company. The primer for the vimentin gene was designed by 5Prime software, using a primer blast design site at the NCBI. The expression View as HTML
Showing 1-4 of 4 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products