OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

MIR145 Human MicroRNA Expression Plasmid (MI0000461)

Be the first to review this product
SKU
SC400175
Expression plasmid for human microRNA MIR145
  $424.00
In Stock*

Frequently Bought Together (1)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00

Other products for "MIR145 or MI0000461"

Specifications
Specifications
Product Data
Species Human
Vector pCMV-MIR
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequences
Precursor: CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGUU:
Mature Sequence: GUCCAGUUUUCCCAGGAAUCCCU:
Full Insert
>MI0000461 CCAGGCTAGGAACTGAATGGTTGGTTTAAATCCACCCCTCTGGCAGGAGACTGGGGAATACACATGAGCC
GTGCAGACAGCAGAGGGCAGTCCTGGGGGTGGGGGCGCCAGAGGGTTTCCGGTACTTTTCAGGGCAATTG
AAGTTCCGGTCACTACTCCCCCCCAGAGCAATAAGCCACATCCGGCGACGTGTGGCACCCCACCCTGGCT
GCTACAGATGGGGCTGGATGCAGAAGAGAACTCCAGCTGGTCCTTAGGGACACGGCGGCCTTGGCGCTGA
AGGCCACTCGCTCCCACCTTGTCCTCACGGTCCAGTTTTCCCAGGAATCCCTTAGATGCTAAGATGGGGA
TTCCTGGAAATACTGTTCTTGAGGTCATGGTTTCACAGCTGGATTTGCCTCCTTCCCACCCCACAGTTGC
CCCCCAATGGGGCCTCGGCTGGCTCACAGGATGAGGGTTCAAGAAGAAGGCTGTCCCTGGAGGTAAGAGG
GCTTATGAACCATGTTCCAAACCTTTGCGTTGCTTTTCTTTCCATCGTGTCTATTTCATAACATCCCTGT
GAGGCTGGATGTGGGAACTTCAGCACTGCCGTACTCTTGGGAAATTTGTCCAAGGCCACCCGGCTGAGCA
GCGGTTGAACCAGGACACCATCAGGCATGCGTTTCTTGTCTCCACCA
Components 1 x 10 ug vial miRNA plasmid lyophilized in a 2-D bar-coded Matrix tube
Also Contains Both mature and minor (star) miRNA can be over expressed from the construct.
OTI Disclaimer All miRNA clones were sequenced to ensure that the pre-mir sequences match reference sequence in miRBase. The flanking sequence of a miRNA clone may differ from the NCBI reference with respect to biological polymorphisms. This should not affect the function of the mature miRNA.
Shipping Ambient
Reference Data
RefSeq MI0000461
Synonyms MIRN145 miR-145 miRNA145
Locus ID 406937
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

MicroRNA-145 replacement effect on growth and migration inhibition in lung cancer cell line
Sadeghiyeh, Sehati, Mansoori et al
Biomed. Pharmacother. (2018) 111, 460-467 DOI: 10.1016/j.biopha.2018.12.094
AI Summary: In this study, the OriGene plasmid containing the miR-145 gene (SKU: SC400344) was used to transfect lung cancer cells, enabling the investigation of miR-145’s effects on cancer cell growth and migration.
Snippet: 42Q6852 K), and incubated at 37 °C in a humidified atmosphere with 5% CO 2 . 2.2. Transfection. A plasmid containing miR-145 gene (Origene, USA, SKU: SC400344) transfection was performed using jetPEI (Polyplus, France) according to the manufacturer's
microRNA-145-3p inhibits non-small cell lung cancer cell migration and invasion by targeting PDK1 via the mTOR signaling pathway
Chen, Zheng, Cai et al
J. Cell. Biochem. (2017)
AI Summary: OriGene contributed to this study by providing the human microRNA-145 expression plasmid (MIR145), which was used to transfect NSCLC cell lines and investigate the effects of miR-145-3p on cell migration, invasion, and the mTOR signaling pathway.
Snippet: Expression plasmid for human microRNA - MIR145 ( ) Origene, USA
miR-21 and miR-145 cooperation in regulation of colon cancer stem cells
Yu, Nangia-Makker, Farhana et al
Mol. Cancer (2015) 14 (1), 98 DOI: 10.1186/s12943-015-0372-7
Cited by 163
AI Summary: In this study, the pCMV/miR145 plasmid from OriGene was used to stably transfect colon cancer cells, enabling researchers to investigate the functional role of miR-145 in regulating colon cancer stem cells and their response to therapy.
Snippet: To determine the putative functional properties of miR-145 in the development of colorectal tumor and its relation to miR21 expression, pCMV/miR145 plasmid (Origene, Rockville, MD) was stably transfected in HCT-116 cells. ... Cite SaveSaving
FigureFigureFigure
Showing 1-3 of 3 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products