OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

GPATCH2 (NM_001297754) Human Untagged Clone

Be the first to review this product
SKU
SC335735
GPATCH2 (untagged) - Human G patch domain containing 2 (GPATCH2), transcript variant 2
  $503.00
2 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA344939 Rabbit Polyclonal Anti-GPATCH2 Antibody - C-terminal region
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "GPATCH2 or NM_001297754"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol GPATCH2
Synonyms CT110; GPATC2; Pfa1; PPP1R30
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC335735 representing NM_001297754.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTTCGGGGCCGCCGGGCGCCAACCGATCGGAGCTCCAGCAGCCGGGAACAGCTGGCATTTCAGTAGA
ACCATGGAGGAGCTGGTTCATGACCTTGTCTCAGCATTGGAAGAGAGCTCAGAGCAAGCTCGAGGTGGA
TTTGCTGAAACAGGAGACCATTCTCGAAGTATATCTTGCCCTCTGAAACGCCAGGCAAGGAAAAGGAGA
GGGAGAAAACGGAGGTCGTATAATGTGCATCACCCGTGGGAGACTGGTCACTGCTTAAGTGAAGGCTCT
GATTCTAGTTTAGAAGAACCAAGCAAGGACTATAGAGAGAATCACAATAATAATAAAAAAGATCACAGT
GACTCTGATGACCAAATGTTAGTAGCAAAGCGCAGGCCGTCATCAAACTTAAATAATAATGTTCGAGGG
AAAAGACCTCTATGGCATGAGTCTGATTTTGCTGTGGACAATGTTGGGAATAGAACTCTGCGCAGGAGG
AGAAAGGTAAAACGCATGGCAGTAGATCTCCCACAGGACATCTCTAACAAACGGACAATGACCCAGCCA
CCTGAGGGTTGTAGAGATCAGGACATGGACAGTGATAGAGCCTACCAGTATCAAGAATTTACCAAGAAC
AAAGTCAAAAAAAGAAAGTTGAAAATAATCAGACAAGGACCAAAAATCCAAGATGAAGGAGTAGTTTTA
GAAAGTGAGGAAACGAACCAGACCAATAAGGACAAAATGGAATGTGAAGAGCAAAAAGTCTCAGATGAG
CTCATGAGTGAAAGTGATTCCAGCAGTCTCAGCAGCACTGATGCTGGATTGTTTACCAATGATGAGGGA
AGACAAGGTGATGATGAACAGAGTGACTGGTTCTACGAAAAGGAATCAGGTGGAGCATGTGGTATCACT
GGAGTTGTGCCCTGGTGGGAAAAGGAAGATCCTACTGAGCTAGACAAAAATGTACCAGATCCTGTCTTT
GAAAGTATCTTAACTGGTTCTTTTCCCCTTATGTCACACCCAAGCAGAAGAGGTTTCCAAGCTAGACTC
AGTCGCCTTCATGGAATGTCTTCAAAGAATATTAAAAAATCTGGAGGGACTCCAACTTCAATGGCTACA
AACTGGACCAGTGAGATTCCCCTATAA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_001297754
Insert Size 1131 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001297754.1
RefSeq Size 3273 bp
RefSeq ORF 1131 bp
Locus ID 55105
UniProt ID Q9NW75
Cytogenetics 1q41
MW 42.6 kDa
Summary The gene encodes a nuclear factor that may play a role in spermatogenesis and in tumor growth during breast cancer. The encoded protein contains a G-patch domain with an RNA binding motif. Alternative splicing results in multiple transcript variants. provided by RefSeq, Feb 2017
Transcript Variant: This variant (2) has multiple differences in the 3' coding region and differs in the 3' UTR, compared to variant 1. The encoded isoform (2) has a shorter and distinct C-terminus, compared to isoform 1.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001297754" in other vectors (2)
SKU Description Size Price
RC237841 GPATCH2 (myc-DDK-tagged) - Human G patch domain containing 2 (GPATCH2), transcript variant 2 10 ug
$289.00 $503.00
RG237841 GPATCH2 (tGFP-tagged) - Human G patch domain containing 2 (GPATCH2), transcript variant 2 10 ug
$703.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products