OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

CCM2 (NM_001167935) Human Untagged Clone

Be the first to review this product
SKU
SC328565
CCM2 (untagged)-Human cerebral cavernous malformation 2 (CCM2) transcript variant 4
  $503.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA503416 CCM2 mouse monoclonal antibody, clone OTI2E4 (formerly 2E4) 100 ul
$447.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "CCM2 or NM_001167935"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol CCM2
Synonyms C7orf22; OSM; PP10187
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC328565 representing NM_001167935.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAAGAGGAGGGCAAGAAGGGCAAGAAGCCTGGAATTGTCTCGCCATTTAAACGAGTATTCCTAAAA
GGTGAAAAGAGTAGAGATAAGAAAGCCCATGAGAAGGTGACAGAGAGGCGCCCTCTGCACACTGTGGTG
TTGTCATTGCCTGAGCGCGTCGAGCCAGACAGACTGCTGAGCGACTATATTGAGAAGGAGGTAAAGTAT
TTAGGTCAGTTAACGTCCATACCAGGATACCTGAATCCCTCCAGTAGGACTGAAATCCTGCATTTCATA
GACAATGCAAAGAGAGCCCACCAGCTTCCGGGACACTTGACTCAGGAGCACGATGCTGTGCTCAGCCTG
TCTGCGTACAACGTCAAGCTGGCCTGGAGGGACGGGGAGGATATCATCCTCAGGGTGCCCATCCATGAC
ATCGCCGCCGTCTCCTATGTTCGGGATGACGCTGCACACCTGGTGGTCCTGAAGACAGATGACTCTTCT
ACAAAAGTGGACATTAAGGAGACCTACGAGGTGGAAGCCAGCACTTTCTGCTTCCCTGAATCTGTGGAT
GTGGGTGGTGCATCACCCCACAGCAAGACCATCAGTGAGAGCGAGCTGAGCGCCAGCGCCACTGAGCTG
CTGCAGGACTACATGCTGACGCTGCGCACCAAGCTGTCATCACAGGAGATCCAGCAGTTTGCAGCACTG
CTGCACGAGTACCGCAATGGGGCCTCTATCCACGAGTTCTGCATCAACCTGCGGCAGCTCTACGGGGAC
AGCCGCAAGTTCCTGCTGCTTGGTCTGAGGCCCTTCATCCCTGAGAAGGACAGCCAGCACTTCGAGAAC
TTCCTGGAGACCATTGGCGTGAAGGATGGCCGCGGCATCATCACTGACAGCTTTGGCAGGCACCGGCGG
GCCCTGAGCACCACATCCAGTTCCACCACCAATGGGAACAGGGCCACGGGCAGCTCTGATGACCGGTCG
GCACCCTCAGAGGGGGATGAGTGGGACCGCATGATCTCGGACATCAGCAGCGACATTGAGGCGCTGGGC
TGCAGCATGGACCAGGACTCAGCATGA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_001167935
Insert Size 1062 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001167935.1
RefSeq Size 1631 bp
RefSeq ORF 1062 bp
Locus ID 83605
UniProt ID Q9BSQ5
Cytogenetics 7p13
MW 39.5 kDa
Summary This gene encodes a scaffold protein that functions in the stress-activated p38 Mitogen-activated protein kinase (MAPK) signaling cascade. The protein interacts with SMAD specific E3 ubiquitin protein ligase 1 (also known as SMURF1) via a phosphotyrosine binding domain to promote RhoA degradation. The protein is required for normal cytoskeletal structure, cell-cell interactions, and lumen formation in endothelial cells. Mutations in this gene result in cerebral cavernous malformations. Multiple transcript variants encoding different isoforms have been found for this gene.provided by RefSeq, Nov 2009
Transcript Variant: This variant (4) represents use of an alternate promoter and 5' UTR, uses a distinct start codon, and lacks two alternate in-frame exons in the central coding region, compared to variant 1. The resulting isoform (4) has a shorter and distinct N-terminus and lacks an internal segment, compared to isoform 1.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001167935" in other vectors (4)
SKU Description Size Price
RC229927 CCM2 (Myc-DDK-tagged)-Human cerebral cavernous malformation 2 (CCM2), transcript variant 4 10 ug
$289.00 $457.00
RC229927L3 Lenti-ORF clone of CCM2 (Myc-DDK-tagged)-Human cerebral cavernous malformation 2 (CCM2), transcript variant 4 10 ug
$757.00
RC229927L4 Lenti-ORF clone of CCM2 (mGFP-tagged)-Human cerebral cavernous malformation 2 (CCM2), transcript variant 4 10 ug
$757.00
RG229927 CCM2 (tGFP-tagged) - Human cerebral cavernous malformation 2 (CCM2), transcript variant 4 10 ug
$657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products