OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

NUSAP1 (NM_016359) Human Untagged Clone

Be the first to review this product
SKU
SC327860
NUSAP1 (untagged)-Human nucleolar and spindle associated protein 1 (NUSAP1) transcript variant 1
  $503.00
4 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA315450 Rabbit polyclonal anti-NUSAP1 antibody
100 ul
$380.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "NUSAP1 or NM_016359"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol NUSAP1
Synonyms ANKT; BM037; LNP; NUSAP; PRO0310p1; Q0310; SAPL
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_016359, the custom clone sequence may differ by one or more nucleotides
ATGATCATCCCCTCTCTAGAGGAGCTGGACTCCCTCAAGTACAGTGACCTGCAGAACTTA
GCCAAGAGTCTGGGTCTCCGGGCCAACCTGAGGGCAACCAAGTTGTTAAAAGCCTTGAAA
GGCTACATTAAACATGAGGCAAGAAAAGGAAATGAGAATCAGGATGAAAGTCAAACTTCT
GCATCCTCTTGTGATGAGACTGAGATACAGATCAGCAACCAGGAAGAAGCTGAGAGACAG
CCACTTGGCCATGTCACCAAAACAAGGAGAAGGTGCAAGACTGTCCGTGTGGACCCTGAC
TCACAGCAGAATCATTCAGAGATAAAAATAAGTAATCCCACTGAATTCCAGAATCATGAA
AAGCAGGAAAGCCAGGATCTCAGAGCTACTGCAAAAGTTCCTTCTCCACCAGACGAGCAC
CAAGAAGCTGAGAATGCTGTTTCCTCAGGTAACAGAGATTCAAAGGTACCTTCAGAAGGA
AAGAAATCTCTCTACACAGATGAGTCATCCAAACCTGGAAAAAATAAAAGAACTGCAATC
ACTACTCCAAACTTTAAGAAGCTTCATGAAGCTCATTTTAAGGAAATGGAGTCCATTGAT
CAATATATTGAGAGAAAAAAGAAACATTTTGAAGAACACAATTCCATGAATGAACTGAAG
CAGCAGCCCATCAATAAGGGAGGGGTCAGGACTCCAGTACCTCCAAGAGGAAGACTCTCT
GTGGCTTCTACTCCCATCAGCCAACGACGCTCGCAAGGCCGGTCTTGTGGCCCTGCAAGT
CAGAGTACCTTGGGTCTGAAGGGGTCACTCAAGCGCTCTGCTATCTCTGCAGCTAAAACG
GGTGTCAGGTTTTCAGCTGCTACTAAAGATAATGAGCATAAGCGTTCACTGACCAAGACT
CCAGCCAGAAAGTCTGCACATGTGACCGTGTCTGGGGGCACCCCAAAAGGCGAGGCTGTG
CTTGGGACACACAAATTAAAGACCATCACGGGGAATTCTGCTGCTGTTATTACCCCATTC
AAGTTGACAACTGAGGCAACGCAGACTCCAGTCTCCAATAAGAAACCAGTGTTTGATCTT
AAAGCAAGTTTGTCTCGTCCCCTCAACTATGAACCACACAAAGGAAAGCTAAAACCATGG
GGGCAATCTAAAGAAAATAATTATCTAAATCAACATGTCAACAGAATTAACTTCTACAAG
AAAACTTACAAACAACCCCATCTCCAGACAAAGGAAGAGCAACGGAAGAAACGCGAGCAA
GAACGAAAGGAGAAGAAAGCAAAGGTTTTGGGAATGCGAAGGGGCCTCATTTTGGCTGAA
GAT
Restriction Sites Please inquire |
ACCN NM_016359
Insert Size 2471 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_016359.3, NP_057443.2
RefSeq Size 2471 bp
RefSeq ORF 1326 bp
Locus ID 51203
UniProt ID Q9BXS6
Cytogenetics 15q15.1
Summary NUSAP1 is a nucleolar-spindle-associated protein that plays a role in spindle microtubule organization (Raemaekers et al., 2003 PubMed 12963707).supplied by OMIM, Jun 2009
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_016359" in other vectors (7)
SKU Description Size Price
RC219159 NUSAP1 (Myc-DDK-tagged)-Human nucleolar and spindle associated protein 1 (NUSAP1), transcript variant 1 10 ug
$289.00 $457.00
RC219159L1 Lenti-ORF clone of NUSAP1 (Myc-DDK-tagged)-Human nucleolar and spindle associated protein 1 (NUSAP1), transcript variant 1 10 ug
$757.00
RC219159L2 Lenti-ORF clone of NUSAP1 (mGFP-tagged)-Human nucleolar and spindle associated protein 1 (NUSAP1), transcript variant 1 10 ug
$757.00
RC219159L3 Lenti-ORF clone of NUSAP1 (Myc-DDK-tagged)-Human nucleolar and spindle associated protein 1 (NUSAP1), transcript variant 1 10 ug
$757.00
RC219159L4 Lenti-ORF clone of NUSAP1 (mGFP-tagged)-Human nucleolar and spindle associated protein 1 (NUSAP1), transcript variant 1 10 ug
$757.00
RG219159 NUSAP1 (tGFP-tagged) - Human nucleolar and spindle associated protein 1 (NUSAP1), transcript variant 1 10 ug
$489.00 $657.00
SC114338 NUSAP1 (untagged)-Human nucleolar and spindle associated protein 1 (NUSAP1), transcript variant 1 10 ug
$300.00

file-alt Citations

MicroRNA-769-5p suppresses cell growth and migration via targeting NUSAP1 in bladder cancer
Chen, Zhang, Kadier et al
J. Clin. Lab. Anal. (2020)
Cited by 21
AI Summary: OriGene’s OE-NUSAP1 plasmid (No. SC327860) was used in this study to upregulate NUSAP1 expression in bladder cancer cells, enabling the authors to investigate the functional impact of NUSAP1 on cell growth, migration, and its interaction with miR-769-5p.
Snippet: … The plasmid applied to upregulate NUSAP1, called as OE‐NUSAP1 and OE‐NC were purchased from OriGene (No. SC327860). … The plasmid applied to upregulate NUSAP1, called as OE‐NUSAP1 and OE‐NC were purchased from OriGene (No. SC327860). …
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products