OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

TCHP (NM_001143852) Human Untagged Clone

Be the first to review this product
SKU
SC325135
TCHP (untagged)-Human trichoplein, keratin filament binding (TCHP), transcript variant 2
  $503.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA342972 Rabbit Polyclonal Anti-TCHP Antibody
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "TCHP or NM_001143852"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol TCHP
Synonyms TpMs
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC325135 representing NM_001143852.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGCTCCCGACGCTGCCGTCCTACTGGTGCAGCCAGCAGCGCCTGAATCAGCAGCTAGCACGACAG
CGAGAGCAGGAGGCCCGGCTTCGGCAGCAGTGGGAGCAGAACAGCCGTTACTTCAGGATGTCTGACATC
TGCAGCTCCAAACAGGCAGAATGGAGCTCTAAAACCTCCTACCAGCGGAGCATGCATGCCTATCAGCGG
GAGAAGATGAAGGAGGAGAAGAGGAGGAGTCTGGAGGCCCGACGGGAAAAGCTCAGGCAGCTCATGCAG
GAGGAGCAGGACCTGCTGGCCAGAGAACTGGAGGAGCTGAGGCTGAGCATGAACTTGCAGGAAAGAAGA
ATCCGGGAGCAGCACGGGAAGCTGAAATCAGCCAAAGAAGAGCAGAGGAAACTGATTGCTGAACAACTT
TTGTACGAACACTGGAAAAAGAACAACCCGAAACTTCGAGAGATGGAGCTGGACCTTCACCAGAAGCAT
GTCGTAAACTCTTGGGAAATGCAGAAAGAAGAAAAAAAACAGCAAGAAGCCACCGCAGAGCAAGAGAAC
AAACGGTATGAAAATGAATATGAAAGGGCCCGAAGGGAGGCGCTAGAAAGGATGAAAGCTGAAGAGGAG
AGGAGGCAGCTGGAGGACAAGCTCCAGGCCGAGGCACTGCTGCAACAGATGGAGGAGCTGAAGCTGAAG
GAGGTGGAGGCGACCAAACTAAAGAAGGAGCAGGAGAATCTGTTGAAGCAGCGGTGGGAGCTAGAGAGG
CTGGAGGAAGAGCGAAAGCAGATGGAAGCCTTCCGGCAGAAGGCAGAGCTGGGGCGTTTCTTGAGACAT
CAGTATAACGCTCAACTCAGCAGACGCACACAGCAGATCCAAGAGGAGCTGGAGGCAGACAGGCGGATC
CTGCAGGCCCTCCTCGAGAAGGAGGACGAGAGCCAGCGCCTCCACCTGGCCAGGCGGGAGCAGGTCATG
GCCGATGTGGCCTGGATGAAGCAGGCCATTGAGGAGCAGCTGCAGCTGGAGCGGGCGCGGGAGGCAGAG
CTGCAGATGCTGCTGAGGGAGGAGGCCAAGGAGATGTGGGAAAAGAGAGAGGCAGAGTGGGCCCGAGAG
CGCAGCGCACGGGACAGACTGATGAGCGAGGTTCTGACAGGGAGACAACAGCAAATACAAGAGAAGATT
GAGCAGAACCGACGGGCACAAGAGGAATCCCTGAAACACAGGGAGCAACTTATTCGAAATCTTGAGGAG
GTGAGAGAGTTGGCTCGTCGCGAGAAAGAGGAGAGTGAAAAGCTGAAATCGGCCAGGAAGCAGGAGCTG
GAAGCCCAGGTTGCAGAGCGCCGGCTGCAGGCATGGGAAGCAGACCAGCAGGAGGAGGAGGAAGAGGAG
GAGGCCCGGCGGGTCGAGCAGCTCTCAGATGCCCTGCTGCAGCAGGAGGCGGAGACTATGGCTGAGCAG
GGCTACCGGCCTAAGCCTTACGGACATCCAAAAATTGCTTGGAACTGA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_001143852
Insert Size 1497 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001143852.1
RefSeq Size 3111 bp
RefSeq ORF 1497 bp
Locus ID 84260
UniProt ID Q9BT92
Cytogenetics 12q24.11
MW 61.1 kDa
Summary Tumor suppressor which has the ability to inhibit cell growth and be pro-apoptotic during cell stress. Inhibits cell growth in bladder and prostate cancer cells by a down-regulation of HSPB1 by inhibiting its phosphorylation. May act as a 'capping' or 'branching' protein for keratin filaments in the cell periphery. May regulate K8/K18 filament and desmosome organization mainly at the apical or peripheral regions of simple epithelial cells (PubMed:15731013, PubMed:18931701). Is a negative regulator of ciliogenesis (PubMed:25270598).UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 both encode the same protein.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001143852" in other vectors (4)
SKU Description Size Price
RC227291 TCHP (Myc-DDK-tagged)-Human trichoplein, keratin filament binding (TCHP), transcript variant 2 10 ug
$457.00
RC227291L3 Lenti ORF clone of Human trichoplein, keratin filament binding (TCHP), transcript variant 2, Myc-DDK-tagged 10 ug
$757.00
RC227291L4 Lenti ORF clone of Human trichoplein, keratin filament binding (TCHP), transcript variant 2, mGFP tagged 10 ug
$757.00
RG227291 TCHP (tGFP-tagged) - Human trichoplein, keratin filament binding (TCHP), transcript variant 2 10 ug
$657.00

file-alt Citations

ERK/ribosomal S6 kinase (RSK) signaling positively regulates death receptor 5 expression through co-activation of CHOP and Elk1
Oh, Liu, Yue et al
J Biol Chem (2010) 285 (53), 41310-9 DOI: 10.1074/jbc.M110.153775
AI Summary: OriGene products contributed to this study by providing specific siRNAs (ERK1/2 siRNA, RSK2 siRNA, and ATF4 siRNA) used to silence gene expression and investigate the roles of ERK, RSK2, and ATF4 in the regulation of DR5 expression.
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products