OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Serum Amyloid A (SAA1) (NM_199161) Human Untagged Clone

Be the first to review this product
SKU
SC324416
SAA1 (untagged)-Human serum amyloid A1 (SAA1), transcript variant 2
  $150.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA600569 SAA1 mouse monoclonal antibody, clone OTI2E4 100 ug
$447.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Serum Amyloid A or NM_199161"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Serum Amyloid A
Synonyms PIG4; SAA; SAA2; TP53I4
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_199161.2 AGGGACCCGCAGCTCAGCTACAGCACAGATCAGCACCATGAAGCTTCTCACGGGCCTGGT
TTTCTGCTCCTTGGTCCTGGGTGTCAGCAGCCGAAGCTTCTTTTCGTTCCTTGGCGAGGC
TTTTGATGGGGCTCGGGACATGTGGAGAGCCTACTCTGACATGAGAGAAGCCAATTACAT
CGGCTCAGACAAATACTTCCATGCTCGGGGGAACTATGATGCTGCCAAAAGGGGACCTGG
GGGTGTCTGGGCTGCAGAAGCGATCAGCGATGCCAGAGAGAATATCCAGAGATTCTTTGG
CCATGGTGCGGAGGACTCACTGGCCGATCAGGCTGCCGATGAATGGGGCAGGAGTGGCAA
AGACCCCAATCACTTCCGACCTGCTGGCCTGCCTGAGAAATACTGAGCTTCCTCTTCACT
CTGCTCTCAGGAGATCTGGCTGTGAGGCCCTCAGGGCAGGGATACAAAGCGGGGAGAGGG
TACACAATGGGTATCTAATAAATACTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire |
ACCN NM_199161
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_199161.2, NP_954630.1
RefSeq Size 569 bp
RefSeq ORF 369 bp
Locus ID 6288
UniProt ID P02735
Cytogenetics 11p15.1
Summary This gene encodes a member of the serum amyloid A family of apolipoproteins. The encoded preproprotein is proteolytically processed to generate the mature protein. This protein is a major acute phase protein that is highly expressed in response to inflammation and tissue injury. This protein also plays an important role in HDL metabolism and cholesterol homeostasis. High levels of this protein are associated with chronic inflammatory diseases including atherosclerosis, rheumatoid arthritis, Alzheimer's disease and Crohn's disease. This protein may also be a potential biomarker for certain tumors. Finally, antimicrobial activity against S. aureus and E. coli resides in the N-terminal portion of the mature protein. Alternate splicing results in multiple transcript variants that encode the same protein. A pseudogene of this gene is found on chromosome 11. provided by RefSeq, Jul 2020
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1, 2 and 3 encode the same protein.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_199161" in other vectors (6)
SKU Description Size Price
RC202738 SAA1 (Myc-DDK-tagged)-Human serum amyloid A1 (SAA1), transcript variant 2 10 ug
$150.00
RC202738L1 Lenti ORF clone of Human serum amyloid A1 (SAA1), transcript variant 2, Myc-DDK-tagged 10 ug
$450.00
RC202738L2 Lenti ORF clone of Human serum amyloid A1 (SAA1), transcript variant 2, mGFP tagged 10 ug
$450.00
RC202738L3 Lenti ORF clone of Human serum amyloid A1 (SAA1), transcript variant 2, Myc-DDK-tagged 10 ug
$450.00
RC202738L4 Lenti ORF clone of Human serum amyloid A1 (SAA1), transcript variant 2, mGFP tagged 10 ug
$450.00
RG202738 SAA1 (tGFP-tagged) - Human serum amyloid A1 (SAA1), transcript variant 2 10 ug
$489.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products