OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

NSDHL (NM_001129765) Human Untagged Clone

Be the first to review this product
SKU
SC323011
NSDHL (untagged)-Human NAD(P) dependent steroid dehydrogenase-like (NSDHL), transcript variant 2
  $503.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA379327 NSDHL Rabbit polyclonal Antibody
100 ul
$475.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "NSDHL or NM_001129765"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol NSDHL
Synonyms H105E3; SDR31E1; XAP104
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC323011 representing NM_001129765.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAACCAGCAGTTAGCGAGCCAATGAGAGACCAAGTCGCACGGACTCATTTGACAGAGGACACTCCC
AAAGTGAATGCTGACATAGAAAAGGTTAACCAGAATCAGGCCAAGAGATGCACAGTGATCGGTGGCTCT
GGATTCCTGGGGCAGCACATGGTGGAGCAGTTGCTGGCAAGAGGATATGCTGTCAATGTATTTGATATC
CAGCAAGGGTTTGATAATCCCCAGGTGCGGTTCTTTCTGGGTGACCTCTGCAGCCGACAGGATCTGTAC
CCAGCTCTGAAAGGTGTAAACACAGTTTTCCACTGTGCGTCACCCCCACCATCCAGTAACAACAAGGAG
CTCTTTTATAGAGTGAATTACATTGGCACCAAGAATGTCATTGAAACTTGCAAAGAGGCTGGGGTTCAG
AAACTCATTTTAACCAGCAGTGCCAGTGTCATCTTTGAGGGCGTCGATATCAAGAATGGAACTGAAGAC
CTTCCCTATGCCATGAAACCCATTGACTACTACACAGAGACTAAGATCTTACAGGAGAGGGCAGTTCTG
GGCGCCAACGATCCTGAGAAGAATTTCTTAACCACAGCCATCCGCCCTCATGGCATTTTCGGCCCAAGG
GACCCGCAGTTGGTACCCATCCTCATCGAGGCAGCCAGGAACGGCAAGATGAAGTTCGTGATTGGAAAT
GGGAAGAACTTGGTGGACTTCACCTTTGTGGAGAACGTGGTCCATGGACACATCCTGGCGGCAGAGCAG
CTCTCCCGAGACTCGACACTGGGTGGGAAGGCATTTCACATCACCAATGATGAGCCCATCCCTTTCTGG
ACATTCCTGTCTCGCATCCTGACAGGCCTCAATTATGAGGCCCCCAAGTACCACATCCCCTACTGGGTG
GCCTACTACCTGGCCCTCCTGCTATCCCTGCTGGTGATGGTGATCAGTCCTGTCATCCAGCTGCAGCCC
ACCTTCACACCCATGCGGGTCGCACTGGCTGGCACATTCCACTACTACAGCTGCGAGAGAGCCAAAAAG
GCCATGGGCTACCAGCCACTAGTGACCATGGATGATGCTATGGAGAGGACCGTGCAGAGCTTTCGCCAC
CTGCGGAGGGTCAAGTGA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Restriction Sites SgfI-MluI |
ACCN NM_001129765
Insert Size 1122 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001129765.1
RefSeq Size 1648 bp
RefSeq ORF 1122 bp
Locus ID 50814
UniProt ID Q15738
Cytogenetics Xq28
Protein Families Transmembrane
Protein Pathways Metabolic pathways, Steroid biosynthesis
MW 41.9 kDa
Summary The protein encoded by this gene is localized in the endoplasmic reticulum and is involved in cholesterol biosynthesis. Mutations in this gene are associated with CHILD syndrome, which is a X-linked dominant disorder of lipid metabolism with disturbed cholesterol biosynthesis, and typically lethal in males. Alternatively spliced transcript variants with differing 5' UTR have been found for this gene. provided by RefSeq, Jul 2008
Transcript Variant: This variant (2) contains an additional 5' non-coding exon, hence has a longer 5' UTR compared to variant 1. Transcript variants 1 and 2 encode the same protein.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001129765" in other vectors (4)
SKU Description Size Price
RC225571 NSDHL (Myc-DDK-tagged)-Human NAD(P) dependent steroid dehydrogenase-like (NSDHL), transcript variant 2 10 ug
$457.00
RC225571L3 Lenti-ORF clone of NSDHL (Myc-DDK-tagged)-Human NAD(P) dependent steroid dehydrogenase-like (NSDHL), transcript variant 2 10 ug
$757.00
RC225571L4 Lenti-ORF clone of NSDHL (mGFP-tagged)-Human NAD(P) dependent steroid dehydrogenase-like (NSDHL), transcript variant 2 10 ug
$757.00
RG225571 NSDHL (tGFP-tagged) - Human NAD(P) dependent steroid dehydrogenase-like (NSDHL), transcript variant 2 10 ug
$657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products