OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Bcl2 Binding component 3 (BBC3) (NM_001127240) Human Untagged Clone

Be the first to review this product
SKU
SC322931
BBC3 (untagged)-Human BCL2 binding component 3 (BBC3), transcript variant 1
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA321834 Anti-BBC3 Rabbit Polyclonal Antibody
100 ul
$305.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Bcl2 Binding component 3 or NM_001127240"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Bcl2 Binding component 3
Synonyms JFY-1; JFY1; PUMA
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_001127240 edited
ATGAAATTTGGCATGGGGTCTGCCCAGGCATGTCCATGCCAGGTGCCCAGGGCTGCTTCC
ACGACGTGGGTCCCCTGCCAGATTTGTGGCCCCAGGGAGCGCCATGGCCCGCGCACGCCA
GGAGGGCAGCTCCCCGGAGCCCGTAGAGGGCCTGGCCCGCGACGGCCCGCGCCCCTTCCC
GCTCGGCCGCCTGGTGCCCTCGGCAGTGTCCTGCGGCCTCTGCGAGCCCGGCCTGGCTGC
CGCCCCCGCCGCCCCCACCCTGCTGCCCGCTGCCTACCTCTGCGCCCCCACCGCCCCACC
CGCCGTCACCGCCGCCCTGGGGGGTTCCCGCTGGCCTGGGGGTCCCCGCAGCCGGCCCCG
AGGCCCGCGCCCGGACGGTCCTCAGCCCTCGCTCTCGCTGGCGGAGCAGCACCTGGAGTC
GCCCGTGCCCAGCGCCCCGGGGGCTCTGGCGGGCGGTCCCACCCAGGCGGCCCCGGGAGT
CCGCGGGGAGGAGGAACAGTGGGCCCGGGAGATCGGGGCCCAGCTGCGGCGGATGGCGGA
CGACCTCAACGCACAGTACGAGCGGCGGAGACAAGAGGAGCAGCAGCGGCACCGCCCCTC
ACCCTGGAGGGTCCTGTACAATCTCATCATGGGACTCCTGCCCTTACCCAGGGGCCACAG
AGCCCCCGAGATGGAGCCCAATTAGGTGCCTGCACCCGCCCGGTGGACGTCAGGGACTCG
GGGGGCAGGCCCCTCCCACCTCCTGACACCCTGGCCAGCGCGGGGGACTTTCTCTGCACC
ATGTAG
Restriction Sites Please inquire |
ACCN NM_001127240
Insert Size 800 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001127240.1.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001127240.1, NP_001120712.1
RefSeq Size 1827 bp
RefSeq ORF 786 bp
Locus ID 27113
UniProt ID Q9BXH1
Cytogenetics 19q13.32
Protein Families Druggable Genome
Protein Pathways Huntington's disease, p53 signaling pathway
Summary This gene encodes a member of the BCL-2 family of proteins. This family member belongs to the BH3-only pro-apoptotic subclass. The protein cooperates with direct activator proteins to induce mitochondrial outer membrane permeabilization and apoptosis. It can bind to anti-apoptotic Bcl-2 family members to induce mitochondrial dysfunction and caspase activation. Because of its pro-apoptotic role, this gene is a potential drug target for cancer therapy and for tissue injury. Alternative splicing results in multiple transcript variants. provided by RefSeq, Dec 2011
Transcript Variant: This variant (1) includes an alternate exon in the 5' coding region, resulting in a frameshift for the remainder of the CDS, compared to variant 2. The encoded isoform (1, also known as PUMA-gamma) has the same N-terminus but is otherwise distinct and longer, compared to isoform 2.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001127240" in other vectors (6)
SKU Description Size Price
RC225345 BBC3 (Myc-DDK-tagged)-Human BCL2 binding component 3 (BBC3), transcript variant 1 10 ug
$300.00
RC225345L1 Lenti ORF clone of Human BCL2 binding component 3 (BBC3), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC225345L2 Lenti ORF clone of Human BCL2 binding component 3 (BBC3), transcript variant 1, mGFP tagged 10 ug
$600.00
RC225345L3 Lenti ORF clone of Human BCL2 binding component 3 (BBC3), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC225345L4 Lenti ORF clone of Human BCL2 binding component 3 (BBC3), transcript variant 1, mGFP tagged 10 ug
$600.00
RG225345 BBC3 (tGFP-tagged) - Human BCL2 binding component 3 (BBC3), transcript variant 1 10 ug
$489.00 $500.00

file-alt Citations

TAT-RasGAP317-326-mediated tumor cell death sensitization can occur independently of Bax and Bak
Annibaldi, Heulot, Martinou et al
Apoptosis (2013)
Cited by 10
AI Summary: In this study, the Puma.cmv plasmid from OriGene, which encodes human Puma, was used to investigate the role of Bcl-2 family proteins in TAT-RasGAP317-326-mediated tumor cell death sensitization.
Snippet: no. 711-035-152). Plasmids. The pcDNA3 expression vector is from Invitrogen. pEGFP-C1 (Clontech) encodes the green fluorescent protein. Puma.cmv (Origene) encodes human Puma. hTP53.dn3 (#703) encodes human p53. ... Cite SaveSaving
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products