OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

BLOC1S2 (NM_001001342) Human Untagged Clone

Be the first to review this product
SKU
SC322335
BLOC1S2 (untagged)-Human biogenesis of lysosomal organelles complex-1, subunit 2 (BLOC1S2), transcript variant 2
  $150.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "BLOC1S2 or NM_001001342"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol BLOC1S2
Synonyms BLOS2; BORCS2; CEAP; CEAP11
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for SC322335 CTGAGGAAGCAAAGGAGCCTGCTGAAGCTGACATCACTGAGCTCTGCCGGGACATGTTCT
CCAAAATGGCCACTTACCTGACTGGGGAACTGACGGCCACCAGTGAAGACTATAAGCTCC
TGGAAAATATGAATAAACTCACCAGCTTGAAGTATCTTGAAATGAAAGATATTGCTATAA
ACATTAGTAGGAACTTAAAGGACTTAAACCAGAAATATGCTGGACTGCAGCCTTATCTGG
ATCAGATCAATGTCATTGAAGAGCAGGTAGCAGCTCTTGAGCAGGCAGCTTACAAGTTGG
ATGCATATTCAAAAAAACTGGAAGCCAAGTACAAGAAGCTGGAGAAGCGATGAGAAACTT
ATTTCTATGGGACAGAGTCTTTTTTTTTTAATGTGGAAGAATGTCTTATAAAACCTGAAT
CCTGAGGCTGATGAATTGTGAAAATTCCTCAAAAGGAAATTATGCTGGTCATCACAGGAA
CATCTCAACGTTCGAGTAAACTGGAGGACTGTGGCTATTCCTGAACCTTCTTTGAGACAG
AATCCCTCAGAATCTCACACTTATAACTTCCTACCTTTTACTTGAATGCTTTGCCATATT
CAGGACAGAGACTCTCACAAAGTTCAGAAAACAGCTGGACTTACCAGTAAAATCAAATGA
GAGGACCTATTTTCTCTGGTAGTGGTTGATTACTACATTATTTTCTTAAGTGGCTGGTTT
TTTAGTTACTATGTAAATGGTCGTTTTTCTGTTAATGATGCTAATGTGTTGTAAACAAGA
TTCTAAATTTAAAAAGGAAAACAAAACAAACTTGTTCTTTGCAGCTTATCACCTTGTGAA
TGTCGGTAACTTACTTTTCCATAATATTGCAAATAACATAAAATCTTAAAATAATTCCAA
GCTGAGTCTTCTAGATTGAGCAGAAATGGTGAAAGGAGTATTGATAACTTGGCGTATGTG
ATGGGCCCCTCTTGTTTATTTTCTATGTGAGTCACATTGACATGCGATCAGTTTGGGAAA
TGTGATGAAAACAAAGACTAGATGGGTATGTGTGTTTATGTGTTGGGTAGGGAGGTGACG
ATTGCCACTCATAAAATAAAGGATTTTATAAAATAAAAAAAAAAAAAAAAAAAAAAAAAA
AA
Restriction Sites Please inquire |
ACCN NM_001001342
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001001342.1, NP_001001342.1
RefSeq Size 2024 bp
RefSeq ORF 300 bp
Locus ID 282991
UniProt ID Q6QNY1
Cytogenetics 10q24.31
Summary This gene encodes a protein with multiple functions. The encoded protein has been found in association with the centrosome, shown to co-localize with gamma-tubulin, and also found to be one of the proteins in the BLOC-1 complex which functions in the formation of lysosome-related organelles. A pseudogene of this gene is located on the X chromosome. Alternative splicing results in multiple transcript variants. provided by RefSeq, Feb 2012
Transcript Variant: This variant (2) uses an alternate 5' exon structure and thus differs in the 5' UTR and 5' coding region compared to variant 1. These differences cause translation initiation at a downstream AUG and result in an isoform (2) with a shorter N-terminus, compared to isoform 1. Variants 2, 4, and 5 encode the same isoform (2). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001001342" in other vectors (4)
SKU Description Size Price
RC202351 BLOC1S2 (Myc-DDK-tagged)-Human biogenesis of lysosomal organelles complex-1, subunit 2 (BLOC1S2), transcript variant 2 10 ug
$150.00
RC202351L3 Lenti ORF clone of Human biogenesis of lysosomal organelles complex-1, subunit 2 (BLOC1S2), transcript variant 2, Myc-DDK-tagged 10 ug
$450.00
RC202351L4 Lenti ORF clone of Human biogenesis of lysosomal organelles complex-1, subunit 2 (BLOC1S2), transcript variant 2, mGFP tagged 10 ug
$450.00
RG202351 BLOC1S2 (tGFP-tagged) - Human biogenesis of lysosomal organelles complex-1, subunit 2 (BLOC1S2), transcript variant 2 10 ug
$350.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products